1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karolina [17]
3 years ago
14

A patient with Cancer of the food pipe ,cannot eat and swallow ,so to feed him ,a tube is inserted directly into his stomach. Pr

operly mashed food is now given to the patient directly through the pipe.
Now that the food is going directly to the stomach instead of through the food pipe ,Which of these is likely to happen.
Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The options are:

A. Water will not be absorbed

B. The kidney will stop working

C. Carbohydrate will not be digested.

D. No major problem will arise

The answer is D. No major problem will arise

Explanation:

This is an endoscopic procedure done to patients who have blocked food pipe.

The Oesophageal stent is a small metal or plastic tube which is put into the food pipe (oesophagus).

A cancer in the food pipe can partly or completely block and make it difficult to swallow. The solution mostly is to put a stent into the blocked area which opens up the food pipe well for the passage of of food. This also permits individuals to swallow food and drink more easily.

The patient normally stays in the hospital overnight or for a few days during this procedure.

You might be interested in
What occurs during the transition from stage A to stage B in figure 2?
Sunny_sXe [5.5K]

Answer:

A

Explanation:

3 0
3 years ago
PLEASE HELP ME!!! WILL GIVE BRAINLIEST!!!
Varvara68 [4.7K]

Answer:

If the amount of caffeine increases, then the breathing rate of goldfish will decrease.

3 0
1 year ago
Read 2 more answers
Which organs perform both mechanical digestion and chemical digestion of food?
kotykmax [81]

Answer: Mouth.

Explanation:  

The mouth is known to be performing both the tasks of chemical digestion and mechanical digestion.

The food is ingested through mouth and the teeth perform the process of mechanical digestion by breaking down the food particles into smaller particles.

Then the saliva gets mixed into the food and the enzymes(amylase) present in the saliva helps in the digestion of carbohydrates.

So, mouth is the organ that performs the process of both mechanical and chemical digestion.

6 0
3 years ago
Read 2 more answers
What does the nucleus of the cell contain?
Alex777 [14]

Answer:

DNA

Explanation:

6 0
3 years ago
How does rough ER from smooth ER?
irinina [24]

Answer:

Rough endoplasmic reticulum differ from smooth endoplasmic reticulum by the presence and absence of ribosomes in their surface.

Explanation:

Rough endoplasmic is named so because RER contain ribosomes at their surface and due to the presence of ribosomes rough endoplasmic reticulum play an importnt role in protein synthesis or translation.

 Whereas smooth endoplasmic reticulum does not contain any ribosome in its surface.smooth endoplasmic reticulum helps in the biosynthesis of lipid and steroids along with detoxification of toxic compounds.

3 0
3 years ago
Other questions:
  • During which step of meiosis homologous chromosomes pair up?
    10·1 answer
  • Which of these is an organisms
    13·2 answers
  • What are the skeletal difference between a biped and a quadruped?
    9·1 answer
  • Which of the following statements about fungi is not true? a. All fungi are useful for plant growth b. Athletes foot is caused b
    13·1 answer
  • What do Americans say is the most desired characteristic in a marriage partner?
    12·1 answer
  • The correct sequence in viral reproduction is
    8·1 answer
  • Each organism in a population produces more offspring than can survive. This is called .
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • When crossing over take places chromsomes
    15·1 answer
  • Which statements describe the process of scientific inquiry
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!