1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
11

True or false? The lungs have an efficient blood supply to take away the oxygenated blood and maintain the concentration gradien

t. PLS HELP IM IN EXAM RIGHT NOW
Biology
1 answer:
ziro4ka [17]3 years ago
8 0

Answer:

true

Explanation:

You might be interested in
PLEASE HELP ! I WILL MARK YOU BRAINLIEST !
viva [34]

Answer:

A

Explanation:

Earth's orbit is not constant because it does not travel in a circle but more of an ellipses.

7 0
3 years ago
Read 2 more answers
research the following terms: gross, profit, total revenue, and gross profit margin .Make a diagram explaining these terms. Then
exis [7]

Answer:

uuiuuuuuijhj until j um internationalization

5 0
3 years ago
Why do some organisms reproduce asexually?
Slav-nsk [51]
Not sure but my best guess is to go with B. It just makes the most sense.
3 0
3 years ago
Read 2 more answers
Distinguishing the Domains of Life
vitfil [10]

Answer:

1) Organisms in this domain can be unicellular or multicellular - Eukarya

2) Organisms in this domain are unicellular and are often found in extreme environments - Archaea

3) Organisms in this domain have cells that contain a nucleus - Eukarya

Explanation:

All living organisms were classified into a large group consisting of three types of organisms called DOMAIN. It is the highest taxonomic rank of organisms. The three domains that life was classified into are: Archaea, Bacteria and Eukarya.

The domain Archaea contains organisms that are unicellular and prokaryotic i.e. they do not have a membrane-bound nucleus. The organisms in this domain are characterized by their ability to survive in harsh environmental conditions e.g hot temperatures etc

The domain Bacteria also consists of unicellular and prokaryotic organisms. They contain cell walls in their cells made up of peptidoglycan unlike domain Archaea and Eukarya.

The domain Eukarya consists of organisms that are both unicellular and multicellular and strictly eukaryotic i.e. possess a membrane bound nucleus that houses their genetic material. They are divided into Kingdoms: Protista, Plantae, Animalia and Fungi.

4 0
3 years ago
Read 2 more answers
In cellular reproduction, ___ ALWAYS occurs in 5’ to 3’ direction
attashe74 [19]

Answer:

DNA replication

Explanation:

DNA replication is the process whereby the genetic material (DNA) duplicates itself into two identical copies. This process must occur prior to any cellular division (meiosis or mitosis) in order to ascertain that each daughter cell gets an even and correct amount of DNA.

The process of DNA replication begins with the unwinding of the double stranded DNA molecule into two single strands of DNA. One strand called leading strand runs from 3'-5' while the other strand runs from 5'-3'. However, DNA replication proceeds in the 5'-3' direction.

4 0
3 years ago
Other questions:
  • explain how Copernicus concluded that stars were farther away than planets. draw a diagram showing this principle to another exa
    5·1 answer
  • Answering a phone when it rings is an example of:
    13·1 answer
  • The temperature on a distant planet is measured to be 183 Kelvin by a space probe. This temperature converts to ______ degrees C
    13·1 answer
  • Exam.
    8·1 answer
  • Contaminated water called leachate from _____ can pollute groundwater.
    6·1 answer
  • Need some help on #59
    7·1 answer
  • What are the three parts of the DNA molecule?
    10·1 answer
  • Which of these provides the best evidence for the plate tectonic theory? (5 points)
    5·1 answer
  • How many crosses of red and white four-o'clock flowers would you need to find out all of the possible phenotypes fo
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!