Which nutrient becomes depleted most rapidly during physical exercise?

Below is the base sequence on one side of a DNA molecule. What would the complimentary side of this strand of DNA read? ATC TCA

Agata [3.3K]

Answer:

nongenima

Explanation:

7 0

2 years ago

With reference to the diagrams below, describe how fishes and bottom dwelling polychaete worms cope with the fluctuating salinit

klasskru [66]

Fishes and bottom dwelling worms cope with the fluctuating salinity within estuaries over the tidal cycle with the use of transport system such as active and passive transport.

<h3>How active and passive transport system are used?</h3>

In salty water, fish and other marine organisms used active transport in which energy is used to remove salts from the body of these marine organisms because excess salts are harmful for them.

So we can conclude that Fishes use transport system such as active and passive transport to cope with the fluctuation of salt concentration.

Learn more about salinity here: brainly.com/question/20283396

#SPJ1

6 0

2 years ago

Explain why programmed cell death (apoptosis) is important.

azamat

An atrophic factors is a force that causes a cell to die, only natural forces on the cell are considered to be atrophic factors,whereas, and agents of mechanical or chemical abuse or lists of the cell are considered not to be atrophic factors. Which affect decrease workload loss of Innervation and diminishes your blood supplies , inadequate nutrition, and loss of enforce in stimulation and senility with compression.

8 0

2 years ago

A geologist finds four layers of sedimentary rock. She determines that no geological events have shifted the layers. She labels

kondaur [170]

The answer is “B is younger than D”

5 0

2 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago