All categories

3 years ago

Which of the following is an example of a population?

Biology

2 answers:

Oksana_A [137]3 years ago

4 0

B.
all leopard frogs in the world

Pavlova-9 [17]3 years ago

3 0

correct answer is d. all plants and animals in grand canyon

You might be interested in

Which of the following describes an allele whose characteristic phenotype is masked by the presence of a second, different allel

brilliants [131]

The allele that can mask the presence of another allele is called dominant. The allele that is masked is recessive and if both alleles can be detected in the phenotype, then they are codominant. If they produce an intermediate phenotype like pink instead of red or white, then they have a relationship of incomplete dominance.

6 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What modern day practice helps prevent an inadequate production of thyroid hormones?

Mama L [17]

Iodized salts helps to prevent an inadequate production of thyroid hormones .

<h3>What is iodized salts ?</h3>

Iodized salt is a table salt . it is a mixture of very little amount of sodium iodide and potassium iodide .

It helps to prevent iodine deficiency .

It is a micronutrient and dietary mineral that is naturally present in the food supply .and also it is a heavy element .generally found near sea coasts .

Iodine deficiency disease includes hypothyroidism .

<h3>What is hypothyroidism ?</h3>

It occurs due to less secretion of thyroid hormone caused by iodine deficiency .it causes stunted growth . it shows low rate of metabolism .

Hypothyroidism includes diseases like myxoedema or gull's disease , cretinism .

Inadequate supply of iodine in diet causes enlargement of the gland known as simple goitre.

<h3>Thyroid hormones :</h3>

It is secreted by endocrine glands known as thyroid gland . it includes two types of hormones known as thyroxine and calcitonin .

Thyroxine is an iodine containing hormone known as tetra-iodothyroxine(80%) and tri-iodothyroxine (20%).

calcitonin is secreted from thyroid gland and is polypeptide hormone .

Learn more about thyroid hormones here:

brainly.com/question/9251938

#SPJ4

4 0

1 year ago

How does atp get converted from food molecules to protein?

nignag [31]

<span>Light energy has to be converted into chemical energy in ATP molecules. Plants change light into sugar molecules and both plants and animals change sugar into ATP molecules, which allows for our survival</span>

3 0

3 years ago

Which are common to both aerobic and anaerobic respiration? Select three options.

Gnom [1K]

Answer:

A). glucose

D). carbon dioxide

E). energy

Explanation:

Aerobic Respiration is characterized as the respiration process(metabolic reaction or breaking down of glucose into energy) that occurs in presence of oxygen while anaerobic respiration takes place in the absence of oxygen. The things that are common in both include glucose, energy, and carbon dioxide. <u>Glucose is broken down in both processes(with or without oxygen) while energy and CO2 are the byproducts/released products of the process</u>. Thus, <u>options A, D, and E</u> are the correct answers.

6 0

3 years ago

Read 2 more answers