1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SpyIntel [72]
3 years ago
11

An atom of argon has three electron shells, all of

Biology
1 answer:
nevsk [136]3 years ago
3 0

Answer:

s

Explanation:

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Nutrition experts recommend that most people eat less than 2,300 milligrams of sodium a day for good heart health. What percenta
Tamiku [17]

Answer:

you didn't add the whole question... :/

Explanation:

sorry...

6 0
3 years ago
Read 2 more answers
A- 0.455 g B- 5.50 g C. 4.56 g D. 0.55 g
serious [3.7K]

Answer:

Maybe it is 5.50 because not much information is given to calculate it or to find it.

3 0
3 years ago
So sorry , i will give whoever does all of these brainlist . :)
Orlov [11]

1. constant speed is a steady speed from start to finish, instantaneous is not constant from start to finish.

2. The average speed of the marble is 5 m/s  (meters per second).

3. Rider 1 will arrive at the destination before Rider 2.

Hope This Helps!  : )

6 0
3 years ago
Kaylee wants to test her hypothesis that she performs better on tests after getting more sleep. In which way will she best be ab
Sergio039 [100]
The best answer is probably letter C
6 0
3 years ago
Other questions:
  • The oceanic nazca plate is being subducted beneath the continental South American plate.what type of plate boundary is this?A)co
    5·2 answers
  • Suggest why the starch and enzyme solutions were kept at 35°C​
    5·1 answer
  • Please select the word from the list that best fits the definition
    6·1 answer
  • C2H60+<br> 02 →<br> CO2+<br> H2O
    11·1 answer
  • Which takes up more space, the dorsal or ventral cavity?
    10·2 answers
  • What is true about cells in animals? they cannot produce food. they can produce food. some animal cells can produce food. they a
    15·1 answer
  • I NEEEEDDDDDD HEEEELLLLPPPPPP PLEASE
    9·1 answer
  • Which of the following is NOT true about the digestive system?<br> It’s question 10
    9·1 answer
  • Pls answer these. I crossed out 13 and 15 because i already answered them. And i BEG YOU don’t just answer for points. I’ll give
    10·2 answers
  • Stores and transports materials in the cell?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!