1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Klio2033 [76]
3 years ago
9

Can someone please help me

Biology
1 answer:
Lorico [155]3 years ago
8 0

Answer:

<em>No, the rock will not move.</em>

Explanation:

As the scenario in the question is depicting, the force applied on the rock by two friends is equal but in the opposite direction. As a result, as the force is equal and working in opposite directions hence, the rock will not tend to move. If the force applied by one of the friends would be greater or lesser than the rock would have moved from its position depending on the force.

You might be interested in
Heritability refers to the extent to which trait variations among individuals are attributable to their differing
LUCKY_DIMON [66]

Answer:

Phenotypes

Explanation:

Heritability refers to the extent to which trait variations among individuals are attributable to their differing observable and most often definitive or measurable physical features, often called phenotypes. Examples of this variation could be something like height or eye colour. Basically it has to be traits that depend on genetics that environmental factors

6 0
2 years ago
What is the phenotype and the genotype of the white flowered offspring shown in the Punnet square below? Explain how you know by
scoundrel [369]

Answer:

Genotype: The letters that make up the individual. E.g. TT or Tt. ▪ Phenotype: The physical characteristics of the particular trait. E.g. Tall or short. ▪ Dominant trait: Signified by capital letter-E.g. T.

Explanation:

Hope this helps pls mark brainliest.

3 0
3 years ago
In humans, to fold the tongue is a dominant trait (L), and the straight tongue is the recessive trait. What are the probabilitie
kaheart [24]

The given question is incomplete as the genotype of the parents is not given, so the answer is providing in the followings case:

1. dominant parent and recessive parent

2. heterozygous parents

Answer:

1. dominant parent and recessive parent:

dominant parents can be represented by LL and recessive parent is represented by ll, so the gametes would be L, L and l, l.

so,

 L    L

l  Ll   Ll

l  Ll   Ll

so there are all offspring in heterozygous condition as we known one or two dominant allele masks the recessive allele for the trait so 100% offspring can fold their tongue.

2. heterozygous parents

In this case, parents have Ll genotype and gametes would be L and l for each parent so,

    L    l

L   LL  Ll

l    Ll    ll

In this case, one is pure dominant and two heterozygous whereas only one is recessive so, the phenotype of offspring that cant fol the tongue would be:

3/4 = 75%

6 0
3 years ago
What 3 glands contribute to makeup of semen
IgorLugansk [536]

the three accessory glands: the seminal vessicles, the bulbourrethhral gland, and the prostate

3 0
2 years ago
5. A moth has two alleles for spots. It can have brown or white spots. The white allele is recessive and
WARRIOR [948]

Answer:

0.7.5

Explanation:

I hope this is right

3 0
2 years ago
Other questions:
  • Select all that apply. Some animals have specific immunity, which means ____.
    14·2 answers
  • A unicellular microorganism was recovered from a hot spring (95oc) in wyoming. the cells lack a nucleus, have a cell wall that l
    14·1 answer
  • What Are animals that eat dead animals remains
    7·1 answer
  • Which type of cell must be affected by a mutation in order for the mutation to be maintained in the gene pool
    12·1 answer
  • Several species of warblers can live in the same spruce tree ONLY because they.
    8·2 answers
  • Three stages of development from an embryo from a fish salamander turtle and chicken . What information about evolutionary relat
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The first organism in most natural food chains is
    11·2 answers
  • Fossils in _______ layers of rock are generally estimated to be _______ than fossils found in the deeper layers. (3 points) Expl
    8·1 answer
  • Biodiversity
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!