1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
3 years ago
9

Definition! Help please!! I give brainliast please help meeee

Biology
2 answers:
Nataly_w [17]3 years ago
5 0
1.cell the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane. Microscopic organisms typically consist of a single cell, which is either eukaryotic or prokaryotic.

2. Organelle any of a number of organized or specialized structures within a living cell.

3. tissue is a cellular organizational level between cells and a complete organ. A tissue is an ensemble of similar cells and their extracellular matrix from the same origin that together carry out a specific function. Organs are then formed by the functional grouping together of multiple tissues.

4.organ a part of an organism that is typically self-contained and has a specific vital function, such as the heart or liver in humans.

5. An organ system is a group of organs that work together to perform a certain function in an organism's body. Most animals and plants have organs, which are self-contained groups of tissues such as the heart that work together to perform one function. ... The human body has 11 different organ systems.

6.organism an individual animal, plant, or single-celled life form.
kvasek [131]3 years ago
4 0

Hopefully I can help with some of these:


Organism - A living thing

Control Center- Nucleus

Organ System - A group of organs that work together to perform one or more functions

Cell - the smallest structural and functional unit of an organism

Homeostasis - any self-regulating process by which an organism tends to maintain stability while adjusting to conditions that are best for its survival

I hope this helped out a bit. Sorry I couldn't do all of them

You might be interested in
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
What do barbell curls and dips have in common? A. They are both leg exercises. B. They both use free weights. C. Neither exercis
erastovalidia [21]

The answer is <u>"D. They are both arm exercises".</u>


A barbell curl refers to a pull-type, segregation practice which works essentially your biceps, yet in addition trains muscles in your lower arms and shoulders somewhat, as well. You can perform barbell curls by grasping a barbell with an underhand grasp, and with your hands isolated by a shoulder-width separate.  

A dip is a compound, push-type practice which works countless in your chest, shoulders, and arms at the equivalent time. Depending on the sort of preparing routine you're utilizing, you might need to utilize dips to point out extraordinary your chest muscles. You can do this by performing Chest Dips in which you fit your body forward while dipping.

3 0
3 years ago
Read 2 more answers
Replication of DNA takes place in the ______ during the ______ phase of Interphase.
inna [77]

Answer:

M phase, Mitosis

Synthesis phase

5 0
3 years ago
Where do the instructions for making protiens come fron
borishaifa [10]

Answer:

Messenger RNA (mRNA) carries the instructions for making proteins. Like DNA, proteins are polymers: long chains assembled from prefab molecular units, which, in the case of proteins, are amino acids. A large molecular machine* called the ribosome translates the mRNA code and assembles the proteins.

8 0
3 years ago
During photosynthesis,__________ is used to break water down into oxygen and hydrogen.
Artist 52 [7]
Sunlight or energy ?
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which organism has the lowest biotic potential?
    10·1 answer
  • Occurs when air traveling over land moves over water, cools down, and travels back over the land
    14·2 answers
  • Mitosis is responsible for what key process in multicellular eukaryotes?
    7·1 answer
  • A change in ________ can often cause mass extinctions of animals that are adapted to warm, tropical waters.
    7·1 answer
  • What type of selection is occurring because baby's with low or high birth rates are less likely to survive?
    14·1 answer
  • The series of diagrams below represents a process carried out by a unicellular organism. This process is know as
    8·2 answers
  • RNA structure is different from DNA structure because only RNA has which of the following?
    11·2 answers
  • In horses, black coat color is influenced by the dominant allele (B) and chestnut coat color by the recessive allele (b). Trotti
    8·1 answer
  • Which type of cell produces new bone tissue by secreting matrix?
    13·1 answer
  • To determine how related two wolves are using dna sequences, you would look for a sequence that:.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!