1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
14

there is a high tide at a location that changes over time the high tide occors later each day because

Biology
1 answer:
Tamiku [17]3 years ago
3 0
It depends on where the moon is in relation to that section of Earth. 
You might be interested in
28. Flowers are derived evolutionary from modified __________________.
Dmitriy789 [7]

Answer:

Flowers are derived evolutionary from modified <u>leaves</u>.

Explanation:

Flowers are modified leaves possessed only by the angiosperms, which are relatively late to appear in the fossil record. The flowering plants have long been assumed to have evolved from within the gymnosperms; according to the traditional morphological view, they are closely allied to the Gnetales.

6 0
3 years ago
What is needed to cause a change in the state of matter?
Vika [28.1K]
Energy is needed to cause a change in the state of matter because adding energy to matter causes a physical change as matter moves from stage to another.
3 0
4 years ago
Read 2 more answers
The period of the embryo begins atand ends withwhich takes about
Inga [223]

Answer:

The first 2 weeks of development is the germinal period. The germinal period begins with conception and ends when the blastocyst is fully placed into uterine tissue. Next, the embryonic period lasts from implantation until about 8 weeks from the time of conception.

Explanation:

The third thru the eighth  week is known as the embryonic period, and the time from the ninth week until birth is known as the fetal period.

7 0
3 years ago
Which of the following statements is true? Two identical cells are created by meiosis. Meiosis is the same as mitosis. Meiosis c
Papessa [141]

Two identical cells are created in meiosis is the correct answer.

4 0
3 years ago
Read 2 more answers
Free energy is the amount of energy available for the cell to carry out its many chemical processes. it is the difference betwee
Semenov [28]
<span>the blank is entropy</span>
8 0
3 years ago
Other questions:
  • Why do we have to close the windows during a fire drill?
    12·1 answer
  • Sulfur oxides (SO2) are responsible for
    15·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which adaptive management stage helps us understand what objectives are actually met?
    12·1 answer
  • Secretions from __________ glands contribute to the acid mantle that inhibits bacterial growth on the skin
    8·1 answer
  • Please help it’s urgent!!!? For these two questions
    11·1 answer
  • Vì sao DNA của Prokaryote phải siêu xoắn
    12·1 answer
  • Explain what would happen to an animal if the vegetation around them disappeared​
    6·1 answer
  • Science: Ecosystem Passage, Jan. 14, 2022 1. Read the passage about the ecosystems. 2. Answer the questions in complete sentence
    15·1 answer
  • When you hold a mug of hot cocoa,you feel a change in temperture.how does the skin detect this change?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!