1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
5

Oil, natural gas, and coal are considered to be nonrenewable resources. Why are these fuels considered to be nonrenewable? A) Th

e burning of these fuels does not allow the waste products to be recycled. B) These fuels are available in a limited supply--when the fuel is used it is no longer available. C) The amount of pollution released from the use of these fuels is much higher than with renewable sources. D) The technology used to generate energy by the use of these fuels is much older and less efficient than current technology.
Biology
1 answer:
Nat2105 [25]3 years ago
4 0

The answer is B) These fuels are available in a limited supply- - when the fuel is used it is no longer available.

You might be interested in
Why are the seasons opposite in the northern and Southern Hemispheres
alex41 [277]

Answer:

throughout the year, the earth tilts. This causes the north pole to be the closest to the sun half the year and the south pole to be the closest to the sun the other half.

Explanation:

3 0
3 years ago
Read 2 more answers
Choose one nonrenewable energy source and one renewable energy source. Describe how the use of each source affects the environme
cluponka [151]
A tree is renewable because it can re grow and make more trees.
Iron is non renewable because it can’t make any more things, you can just use it that one time
7 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What will happen if natural predators are removed from a habitat?
Fittoniya [83]
The prey will decrease
7 0
3 years ago
Where does the carbon in fossil fuels come from?
fiasKO [112]

Answer: Fossil fuels are made up of dead plant life example trees, bushes, etc., and when burned they release carbon in the air

4 0
3 years ago
Other questions:
  • White moths were found in huge numbers in the English city of Birmingham. These moths could be easily camouflaged by the trees b
    13·2 answers
  • HELP! idk what things in plant cell are which. The directions are to color the objects in the cell according to what color is ne
    12·1 answer
  • A complete circuit contains two parallel-connected devices and a generator for providing the electromotive force. The resistance
    11·1 answer
  • An organisms blank are located on threadlike structures called chromosomes
    8·1 answer
  • RNA molecules control protein production in ribosomes. True or false
    5·2 answers
  • Ravi ran 200 metres race in sports day. He feels that his heart was beating faster than usual. a) Why was his heart beating fast
    5·1 answer
  • What happens at each of the 3 cell cycle checkpoints.?
    15·1 answer
  • Need help asap <br> - 20 points included <br> it’s a quiz !
    6·1 answer
  • Which change is an example of a response to a stimulus?
    5·1 answer
  • How does nitrogen in fertilizer runoff affect aquatic ecosystems
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!