1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valkas [14]
3 years ago
14

The type of fruit that is derived from one flower with many separate carpels is a _____________ fruit

Biology
1 answer:
Leto [7]3 years ago
7 0
The answer is an Aggregate fruit
You might be interested in
Which of the following is not a typical pattern found in the earth's system
Alla [95]
<span>Something that occurs outside the spheres of the earth
Consider that human beings or living organisms live in the biosphere. Biosphere is the collective group of living organisms and their interaction to one another and –ecosystem- to their environment. Human beings like animals or plants are part of the biosphere, one of the spheres in the earth. We have the atmosphere (air), lithosphere (land), hydrosphere (water) and the biosphere (life/ living organisms). Each is with a specific and distinctive characteristics to play in the earth’s existence at the current era.<span>
</span></span>
4 0
3 years ago
The graph below shows the long term average monthly temperature of a place which climate zone is the place likely to be found ex
daser333 [38]
What graph!? If u want me to answer that u have to include a graph sooooo ya
8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which structure best makes Bermudagrass successful in preventing soil erosion
valentina_108 [34]

Bermuda grass is successful in preventing soil erosion because the roots of the Bermuda grass can grow deep and it can reach 6 feet deep more on its surface. Also when the Bermuda grass is damaged it can grow back quickly. 

7 0
3 years ago
Drag each tile to the correct location on the chart. What are the pros and cons of sexual and asexual reproduction?
levacccp [35]

Answer:

Sexual reproduction:

Pros: leads to greater genetic variation.

Cons: requires more time and energy.

Asexual reproduction:

Pros: Does not require finding a mate.

Cons: Produce less genetic variation.

Explanation:

Sexual reproduction is a type of reproduction in higher organisms, in which new individuals are formed by combining genetic information from two different types (sexes) of individuals.

Advantage: Sexual reproduction leads to higher genetic variation due to recombination between genetic material of female and male gamete during meiosis.

Disadvantage: Sexual reproduction is a time and energy consuming process as it needs interaction between mates and organisms which are produced sexually require more time for development.

Asexual reproduction involves formation of new organisms from a single parent organism without gamete fusion.

Advantage: Asexual reproduction requires less time and energy as it does not require finding a mate.

Disadvantage: Asexual reproduction produces less genetic variations as it involves only parent organisms (no mixing of genetic information) and the only source of variations are random mutations.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Why is it so important that a scientist accurately describes the procedure used in an experiment?
    7·1 answer
  • Where are most modern divergent plate boundaries found? where are most modern divergent plate boundaries found? within continent
    11·1 answer
  • Four real life examples of scientific investigation
    15·1 answer
  • Which of the following personal health practices should a person follow to prevent heart diseases?
    12·2 answers
  • What are the two types of orientation behavior? Provide an example of each.
    6·1 answer
  • What are currents ????????
    15·2 answers
  • 9) In a typical food chain, about what percentage of energy is passed on to the next trophic level? A) 1% B) 10% C) 20% D) 40%
    15·1 answer
  • (iii) Parts of _________ help us to maintain body balance
    8·2 answers
  • Why is the Earth separated into different layers?
    6·1 answer
  • Which of the following is a major category of animal tissue?A. EpitheliumB. LymphC. Blood serumD. Heart
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!