1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
3 years ago
12

Compare epidemic and murine typhus.

Biology
1 answer:
Sonbull [250]3 years ago
5 0

Answer:

The major differences between murine and epidemic typhus are their infection mode.

Explanation:

Typhus is a fever disorder that can be endemic or epidemic in nature. Both disorders are pathological and sociologically similar. Endemic typhus is also called as murine typhus.

murine typhus includes several symptoms such as high fever, rashes on the trunk of the body, nausea, diarrhea, and vomiting and infects by the flea feces contact to cut or open wound.

Epidemic typhus is a similar disorder but with more serious symptoms, including hypotension, bleeding into the skin, delirium, and death and spread by infected body lice.

Thus, the major differences between murine and epidemic typhus are their infection mode.

You might be interested in
Darwin’s finches evolved on an island. What is the main reason that islands often provide good examples of evolution?
Gnesinka [82]
Islands are isolated
6 0
3 years ago
Read 2 more answers
An advantage of selective breeding is
Sladkaya [172]
A
learned this in bio last ye
7 0
2 years ago
What do the carbon, nitrogen, hydrologic, and mineral/phosphorus cycle all have in common?
OverLord2011 [107]

Answer:

They all include an exchange of gases with the atmosphere.

The carbon, oxygen, and nitrogen cycles are biogeochemical cycles meaning the chemicals spend a portion during the cycle in living things ( bio) and a portion in the nonliving environment

4 0
3 years ago
What aspect of chromosome behavior most clearly accounts for mendel's law of independent assortment?
makkiz [27]
The aspect of chromosome behavior that most clearly accounts for Mendel's Law of Independent Assortment is the replication of chromosomes. The replication occurs before meiosis. As a result, the alleles of one gene can be sorted into gametes and are independent of the alleles of other genes.   
8 0
4 years ago
1.3.1 A form of security required by the bank before granting a loan 1.3.2 A financial statement that summarises the assets and
noname [10]

1.3.1 A form of security required by the bank before granting a loan is called collateral.

1.3.2 A financial statement that summarises the assets and liabilities of the business is called a balance sheet.

1.3.3 A document that provides an estimate of expected income and expenditure for a given period is an income statement.

1.3.4 The combination of product, pricing, placement, and promotion is called the marketing mix.

1.3.5 The sequence of steps involved in transferring products from the farm to the consumer​ Direct marketing.

An asset that a lender accepts as collateral for a loan is referred to as collateral. Depending on the loan's purpose, collateral may be in the form of real estate or other forms of assets. For the lender, the collateral serves as a type of insurance.

The act of presenting an offer directly to a target client and providing them with a way to respond immediately is known as direct marketing. It is sometimes referred to as direct response marketing among practitioners. Advertising, in contrast, is a form of mass messaging.

To know more about collateral refer to:  brainly.com/question/6779619

#SPJ9

6 0
1 year ago
Other questions:
  • True or False: Bacteria that do not have flagella are never moved from one place to another.
    5·1 answer
  • To perform active transport , cell use
    14·2 answers
  • The chemical process for respiration
    14·2 answers
  • 2. Describe sexual reproduction.
    6·2 answers
  • What is an example of a cell membrane?
    8·1 answer
  • Confined aquifers are found _____.
    13·2 answers
  • A nurse is preparing to administer ampicillin 500 mg in 50 ml of dextrose 5% in water (d5w) to infuse over 15 min. the drop fact
    9·1 answer
  • How do plant and animal cells differ in relation to the need for energy and source of energy ?
    15·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How does meiosis create haploid gametes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!