1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OverLord2011 [107]
3 years ago
15

What are two effects of too much exposure to radiation

Biology
2 answers:
liq [111]3 years ago
7 0
Heat and flame jetting

garik1379 [7]3 years ago
5 0
I think cancer, and birth defects. 
You might be interested in
The hormone that helps male gametes mature is
yan [13]

Answer:

Testosterone or Follicle Stimulating Hormone

Explanation:

I think its the second one

5 0
3 years ago
Which study involves the collection of information supported by opinions? the study of the effect of playing in the rain on catc
Phoenix [80]
Pseudoscience means the process that would involve the collection of information as well as ideas with a belief or opinion. The answer would be the study of the effect of a full moon in regard to human behavior.Hope this would help.
5 0
3 years ago
Read 2 more answers
5. Una población de perezosos de tres dedos en un bosque
bonufazy [111]
Es la b porque 275x0.8 = 220

Espero y te sirva
8 0
3 years ago
Suppose that life exists elsewhere in the universe. all life must contain some type of genetic information, but alien genomes mi
Snowcat [4.5K]
<span>While alien genomes may be constructed by completely different molecules (for example, silicon based life forms are a possibility rather than carbon) it is logical to assume that all life forms would have some sort of protective mechanism to prevent the degradation of DNA during replication. Essentially, to prevent mutations and rapid aging, DNA, alien or otherwise, would have some types of telomeres. They might either be long chains of repeated or irrelevant code or molecules that would not be easily corrupted.</span>
3 0
3 years ago
Which of the following can lead to coral bleaching?
Andru [333]

Answer:

increased solar radiation

Explanation:

during summer the solar radiation can increase the bleaching of shallow living corals as tides gets lower the solar radiation increases

8 0
2 years ago
Other questions:
  • Changes to the global climate could include___.
    8·1 answer
  • What is foud in an animal cell,but not in a plant cell
    5·1 answer
  • You perform a testcross using F1 dihybrid flies. If, in the resulting offspring, the percentages of parental and recombinant off
    15·1 answer
  • Is Mike Vargas soft?
    11·2 answers
  • I need help with this question. Anybody wanna help?
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How big is the earth
    8·1 answer
  • Foliated metamorphic rocks have mineral grains that are randomly placed.<br><br> T<br> F
    5·2 answers
  • h u m m HELP A GIRL OUT "are finches with very small, medium, or very large beaks most likely to survive in times of normal rain
    6·1 answer
  • The ___________ inside the bladder is formed by imaginary lines connecting the two ureter openings and the urethral opening.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!