1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ipatiy [6.2K]
3 years ago
10

!HURRY! 20 POINT!

Biology
1 answer:
dolphi86 [110]3 years ago
7 0

Answer:

The problems that is represent Dubai are the follows:

-Rely heavily on oil

-Spend a lot of energy

-Don't have Parkland

Explanation:

This city is compose for all technologies and nothing of rural or other things that help to the environmental, need more Parkland but this city increase a lot how city.

You might be interested in
Which process drives Darwin’s theory of evolution?
Oksanka [162]
Natural selection is the right answer hope this helps.
8 0
3 years ago
Read 2 more answers
What kind of evidence would be needed in order to change any part of cell theory?
Anvisha [2.4K]

Answer:

In order to change any part of the cell theory, we will have to prove that the cells are not the basic unit of life. We will have to provide evidence that a cell does not distinguish a living thing from a non-living thing. We will either have to prove the spontaneous generation to be true or have to prove that if not cells, then what are the basic units of life. We will also need evidence to prove that a cell does not arise from a pre-existing cell.

5 0
3 years ago
The ______ ____________ (two words) separates the prokaryote internal environment from the external environment and is made of t
miskamm [114]

Answer:

The answer is Plasma Membrane

4 0
3 years ago
What's the lifecycle of HPV? (HUMAN PAPILLOMAVIRUS)
Masteriza [31]

Answer:

Explanation:

HPV DNA replication during its life cycle occurs in three separate phases (reviewed in [1, 2]). After viral entry into the cell nucleus and the activation of viral gene expression, the viral genome copy number increases to several hundred copies per cell during the initial phase of genome amplification.

4 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • Are Flakes of brick Mechanical or Chemical Weathering
    9·2 answers
  • What is true about gradualism with respect to punctuated equilibrium
    14·1 answer
  • In eukaryotes, gene regulation occurs at the level of transcription with the help of certain regulatory proteins. Which proteins
    11·2 answers
  • I need help ASAP!!!!
    5·1 answer
  • What is a cells power plant
    5·2 answers
  • What is the best definition for Earth's atmosphere?
    9·2 answers
  • A scientist tracked the summer eating habits of brown bears. His results are shown in the graph below.
    15·2 answers
  • Please please help it due in an hour!!!! ;-; I'll give brainlst to whom ever is correct!!
    15·2 answers
  • Clark case summary for gizmo
    7·1 answer
  • A day on Earth is approximately 24 hours, which is the amount of time it takes for Earth to complete one
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!