1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
11

Think of an item made by humans that could be broken down by the agents of physical and chemical weathering

Biology
1 answer:
maxonik [38]3 years ago
6 0
Great wall
sea barriers
You might be interested in
Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosph
ss7ja [257]

Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.

Hydrogen ions are actively transported out of the mitochondrial matrix.

Hydrogen ion concentration is higher in the intermembrane space than in the mitochondrial matrix.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Major changes to the formation happen due to ___ or ____ changes to the rock surface.
natka813 [3]
Major changes to the formation happen due to heat or pressure.
6 0
3 years ago
Susan sat out in the sun watching a baseball game. She developed small blisters on her unprotected shoulders and neck. What type
Simora [160]

Second-degree burn is the type of burn represented by the formation of the blisters.

Second-degree burn is a burn that affects the epidermis and the superficial part of the dermis layer (skin). Second-degree burn may be caused by sunburn, chemicals, scald injuries, flames or electricity. The burn site may appear blistered, red, wet and shiny, and may be swollen and painful.


8 0
4 years ago
PLZ HELP ME Question 3
Flauer [41]

Answer:

It's impossible to predict the phenotype of the offspring by only observing the parents because DNA from their grandparents can affect the offspring as well.

Explanation:

DNA is combined from the parents to create offspring. When that offspring reproduces their children not only possess DNA from their parents but from their grandparents as well. Mixing together two separate DNA's from two different family trees can result in rare genetic mutations which results in the offspring looking different from their parents but showing resemblance to their grandparents. This is why you have to look at the phenotypes of more then just the two parents because there are more possibilities, including what their grandparents looked like.

8 0
3 years ago
Other questions:
  • The quickest parenteral method of administering fluids and electrolytes to an animal is?
    10·1 answer
  • PLEASE HURRY YOU WILL GET 99 POINTS explain how musculs are effected in space and what's inporten of international space
    8·2 answers
  • ​in which would the letter "p" be fastest recognized by an individual who spoke english
    9·1 answer
  • Molecules A and B come in contact with the cell membrane of the same cell. Molecule A passes through the membrane readily, but m
    7·1 answer
  • What is the purpose of plants having mitochondria if they have chloroplasts?
    5·1 answer
  • There are two main ways in which molecules are transported into and out of cells, active transport and passive transport. Which
    7·2 answers
  • What type of macromolecule provides insulation?
    7·1 answer
  • After an investigation, Kuri determines that her hypothesis was wrong. What is the best thing for Kuri to do next?
    15·2 answers
  • All the genetic information within an organism is found in its<br> A. DNA<br> B. Proteins<br> C. RNA
    5·2 answers
  • Ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!