1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arturiano [62]
3 years ago
9

What causes the motion of particles

Biology
1 answer:
Naya [18.7K]3 years ago
6 0

Answer:

Particles in solids are always vibrating (moving back and forth) in place. The vibrational motion of particles in solids is kinetic energy. Heat makes the particles in a solid vibrate faster, giving them more kinetic energy. Faster-vibrating particles bump into one another more often and hit each other harder.

Explanation:

Hope this helps- good luck! ^w

You might be interested in
Which of the following lower limb muscles plays an important role in maintaining posture?
Alona [7]
I believe the correct answer would be C. Sartorius   i believe this is the answer, after doing some research on gO0gLe.

6 0
3 years ago
True or false... according to the plum pudding model, electrons are distributed randomly throughout the positively charged “pudd
nexus9112 [7]
This question is true
7 0
3 years ago
Read 2 more answers
Both renewable and nonrenewable resources are used within our society. How do the uses of nonrenewable resources compare to the
natima [27]
I would say that the most correct statement is the following one:
Certain types of renewable energy can be used for as many applications as certain types of nonrenewable resources.

Let's take for example the energy from solar panels (the renewable energy source) and the energy from burning fossil fuels: this energy can be used in the same situations!

8 0
3 years ago
Read 2 more answers
What are the five trophisms
gtnhenbr [62]
Phototropism, Gravitropism, Thigmotropism, <span>Hydrotropism and Heliotropism</span>
3 0
3 years ago
Who discovered the ABO human blood<br>groups?​
bagirrra123 [75]
Answer: Karl Landsteiner
5 0
3 years ago
Read 2 more answers
Other questions:
  • _________ , an enzyme, is produced in the stomach and breaks some of the peptide bonds in polypeptide chains. question 9 options
    12·2 answers
  • What are the major advantages and disadvantages of using coal, oil, and natural gas?
    13·1 answer
  • Complex organisms produce sec cells that unite during fertilization forming a single cell known as?
    10·1 answer
  • can someone explain this to me please - Feeling of dedication and loyalty to a cause, activity or job ​
    8·1 answer
  • Mature red blood cells expel their nuclei so that they have more surface area to transport oxygen and
    13·1 answer
  • 1. Jackie carries a 100 N box a distance of 5 meters. what direction is the force and the distance?​
    9·2 answers
  • what do you think happened to the light from the lightbulb as it passed through the gas cloud before passing through the spectro
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which is a symbol that represents SI units for temperature?<br> °C<br> g<br> L<br> °F
    10·1 answer
  • HELP!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!