1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
13

Which of the following is an accurate description of an adult stem cell?

Biology
1 answer:
frosja888 [35]3 years ago
4 0
I believe the answer is C). My reason for this is because multipotency stands for multidifferentiative potential. And this is the ability to generate progeny of quite a few distinct cell types. And adult stem cells have that ability. Hope this helps.
You might be interested in
Which of the bones in the collection Belongs to the axial skeleton
lara [203]
Bones in your skull (cranial and facial bones), ears, neck, vertebrae, sacrum and tailbone and ribcage (sternum and ribs).
8 0
2 years ago
Read 2 more answers
1. A volcanic eruption levels the land in the surrounding area,
vladimir2022 [97]

Answer:pp

Explanation:pp

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
In which of the following ways are bacteria similar to birds? A: They both keep their DNA in membrane bound nucleus. B: They bot
Tamiku [17]
D. because if you think about the dna is the same as thier genetic material/genes whatever you want to call it.

7 0
2 years ago
Read 2 more answers
All of the following are considered a higher-order trait in Hans Eysenck's hierarchy of traits except ____________. psychoticism
podryga [215]

Answer:

According to Quiz let, D

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • What is the classification level in which classes with similar characteristics are grouped together
    5·1 answer
  • Match the following cell structures with their functions.
    9·2 answers
  • To living organisms, the most dangerous debris from tephra is probably _____, because it spreads so widely. huge volcanic boulde
    13·2 answers
  • Which of the following properties of carbon give it particular importance to life
    12·1 answer
  • How is cytokinesis different in animals and plants? Animal cells get pinched into two daughter cells by the cell membrane; the p
    8·2 answers
  • Foreign cells that enter our body have unique cell surface proteins, known as ________, which stimulate our body's defense to at
    12·2 answers
  • Which of these terms best describes a rural community? Select the two correct responses
    15·2 answers
  • Can someone help me
    11·1 answer
  • What nerve is carrying the afferent and efferent impulses.
    12·2 answers
  • I need help with these two questions ASAP please
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!