1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svet_ta [14]
3 years ago
14

Hypersecretion of aldosterone results in hypokalemia, which causes hyperpolarization of neurons; this in turn results in ______.

Biology
2 answers:
lys-0071 [83]3 years ago
5 0
<h2>Respiratory Acidosis</h2>

Explanation:

  • <em><u>The need for a stronger than normal stimulus in order to trigger an action potential</u></em>
  • The reasons for impaired respiration include aviation route obstacle, discouragement of the respiratory focus in the<em> brain stem, lung disease, and medication overdose</em>
  • The <em>hypoventilation </em>brings about raised c<em>arbon dioxide levels in the blood, the H levels increment, and the pH estimation of the blood decreases</em>
  • Respiratory acidosis is a health related crisis in which diminishes the <em>blood's pH</em> (a condition by and large called acidosis) and the ventilation increases the <em>concentration of carbon dioxide in the blood</em>
Evgesh-ka [11]3 years ago
5 0
<h2>Hyperpolarization </h2>

Explanation:

Hyperpolarization of neurons in turn results in the need for a stronger than normal stimulus in order to trigger an action potential (action potential is an efficient signaling process by which distantly located cells communicate to each other)        

To trigger an action potential cells must reach threshold (critical electrical value required to open voltage-gated ion channels)

If the membrane potential is hyperpolarized and falls below normal resting membrane potential, then more cations must enter the cytoplasm for the cell to reach threshold

You might be interested in
The measure of gravity on Earth determines our __________.
OlgaM077 [116]

Answer:

Explanation: mass is the correct answer

3 0
3 years ago
Read 2 more answers
Like plants, human beings have similarities and differences. God gave us talents which He wants us to use. What can you do best?
asambeis [7]
Well, humans have talents. Whether those talents are god given is up for debate. I'd argue those talents are a result of millions of years of evolution and natural selection as proven by Charles Darwin, not given by an unproven deity, but I don't know what school year you are in so you may not have escaped the years where religion is forced upon you :P

Anyway, if you're being asked this question, what do <em>you </em>like doing? I'd say my talent lies in science, as I was the top performing physicist throughout my gcse years, and I love the subject. In my opinion what you do best is what you love doing most, as if you have a passion for something it will almost always be your best talent. I can't answer that question for you.

Sharing this talent to others is basically teaching and also spreading your passion for your talent to others. They probably won't ever be as good as you because they will have their own talents and passions, but you can give them an insight into it by teaching them what you know and encouraging them to invest some time into it.
6 0
3 years ago
A pattern of relationships among individuals that benefits the society​
Eva8 [605]

Answer:

Explanation:

The relation between individual and society is very close. Essentially, “society” is the regularities, customs and ground rules of anti human behavior. These practices are tremendously important to know how humans act and interact with each other. Society does not exist independently without individual.

7 0
3 years ago
Complete the following statements about the reproductive system.
Naddik [55]

Answer:

Reproductive cells are called: Gametes.

Female Reproductive cells: Egg.

Male reproductive cells: Sperm.

Explanation:

In sexual reproduction each sex has 2 reproductive cells, the egg and the sperm. Sperm fertilizes the egg and the egg will now grow into an embryo. As a whole those two cells are called gametes but depending on gender they have different names.

4 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Which list below describes the next steps of evaporated water through the water cycle?
    6·1 answer
  • Which object is created during the formation of a start
    11·1 answer
  • Horses and zebras can be bred to produce a zorse, which is sterile. Which is most likely the reason zebras and horses are consid
    7·2 answers
  • You go to a hair salon for a haircut and end up buying a tube of styling gel as​ you're checking out. the haircut is​ a(n) _____
    8·1 answer
  • Select all that apply. Many insects go through different physical changes during growth. These insects include the _____.
    12·1 answer
  • In which phase of mitosis are the chromosomes lined up in the middle of the cell?
    7·1 answer
  • What type of model is a diagram of the core (inside) of the sun? A-visualization B-conceptual C-mathematical D-interactive
    14·1 answer
  • SOMEONE HELP ME PLZ!!!!!!!!!!!!
    10·2 answers
  • What is the name of the distal part of the radius?
    7·2 answers
  • Describe the energy transformation when a match burns.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!