1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
3 years ago
10

Can someone help me with question 2 plz

Biology
2 answers:
alina1380 [7]3 years ago
7 0
This is a clear case of photosynthesis. The plants gathered CO2 that the animals exhaled and then made it into clean air. This cycle continued.
MA_775_DIABLO [31]3 years ago
4 0
The plants were providing the necessary oxygen for the animals to breathe and the animals were serving as an aide in photosynthesis for the plants by producing carbon dioxide.
You might be interested in
How many hearts does the octopus have ?​
ira [324]

Answer:

3

Explanation:

4 0
3 years ago
Read 2 more answers
A bear would be classified as a/an
Oksana_A [137]
Mammal? Is this for science or?
8 0
3 years ago
Read 2 more answers
Which of the following is common to both eukaryotic and prokaryotic cells?
Helga [31]
<span>Prokaryotes don't have a nucleolus as they do not have a nucleus, and neither do they have a Golgi apparatus. A nucleoid is loose DNA which is found in prokaryotes but not in eukaryotes...</span>
8 0
3 years ago
Read 2 more answers
When is the only time a black spider monkey sets foot on the ground
yawa3891 [41]

Answer:

hey have long, lanky arms and prehensile (gripping) tails that enable them to move gracefully from branch to branch and tree to tree. These nimble monkeys spend most of their time aloft, and maintain a powerful grip on branches even though they have no thumbs.

These New World primates are social and gather in groups of up to two- or three-dozen animals. At night, these groups split up into smaller sleeping parties of a half dozen or fewer. Foraging also occurs in smaller groups, and is usually most intense early in the day. Spider monkeys find food in the treetops and feast on nuts, fruits, leaves, bird eggs, and spiders. They can be noisy animals and often communicate with many calls, screeches, barks, and other sounds.

Explanation:

8 0
3 years ago
Read 2 more answers
If enough heat is added to a gas, which of the following would most likely happen?
Anvisha [2.4K]

Answer:

I think the answer is D. it would become plasma

3 0
3 years ago
Read 2 more answers
Other questions:
  • A key reason older adults suffer bone fractures is as a result of
    9·2 answers
  • Who discovered the impermanence of sexual phenotypes?
    15·1 answer
  • According to the article on snakes, what unique characteristic has led scientists to study the paradise tree snakes of South Asi
    11·1 answer
  • How many legs does a spider have?
    15·1 answer
  • Which best describes an amino acid?
    12·1 answer
  • nsulin functions in the body by: Select one: a. metabolizing glucose to make energy. b. enabling glucose to enter the cells. c.
    10·1 answer
  • ¿Qué características crees que deben tener los métodos anticonceptivos para ser eficaces en el control de la natalidad?
    12·1 answer
  • What process is occurring in the plant’s cells to produce the gas in the bubbles that appear?
    9·1 answer
  • Which of the following statements about bioremediation is FALSE?
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!