1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djverab [1.8K]
3 years ago
15

Much of an ocean beach is covered in sand dunes and grasses. The homeowners along the beach propose to flatten out the dunes and

remove the grasses, which would allow more visitors to use the beach for swimming and sunbathing. If the homeowners' plan is enacted, which is the most likely consequence?
Biology
1 answer:
s2008m [1.1K]3 years ago
3 0

Answer:

The beach will face destructive storms and excessive erosion increasing chances of experiencing hurricanes.

Explanation:

Grass and sand dunes on the oceans beaches are a defense mechanism against destructive winds which blow away beach sand. Sand dune size and available vegetation act as protective barriers against storm waves to prevent destruction of building and property located landwards of the dune.Dunes and vegetation should be protected as a way of taking care of our ecosystem.

You might be interested in
What is the prime mover in anatomy?
ozzi

Answer:

prime mover sometimes called the agonist,is the muscle that provides the primary force driving the action

8 0
3 years ago
If a product is recycled, is anything lost in terms of material or energy?
V125BC [204]
No, because it is reused
7 0
3 years ago
Read 2 more answers
I would say D . is it correct?
DaniilM [7]

Answer:

Yep i would to.

Explanation:

7 0
4 years ago
What is the function of T-lymphocytes? Select all
emmainna [20.7K]

Answer:

to assist other lymphocytes

to kill cells infected with a virus or cancer

to help in the body’s immune response

Explanation:

3 0
3 years ago
How do organisms carry out chemical activities of life
bixtya [17]
The choices can be found elsewhere and as follows:

<span>A) by using energy
B) through asexual reproduction
C) metabolism

I think the correct answer is option C. Organisms </span><span>carry out chemical activities of life would be metabolism. Hope this answers the question.</span>
5 0
3 years ago
Other questions:
  • . In preparation for mitosis, DNA is copied; this is called DNA ______________________.
    11·2 answers
  • Explain why a mark on a blade of grass will move away from the ground as the grass blade grows, but a similar mark on a tree tru
    12·2 answers
  • During metabolism the complete of one molecule of glucose results in a maximum yield if 38 molecules of
    6·1 answer
  • The same agricultural practices are used in every country of the world.
    8·2 answers
  • Which of the following is most important in making the typical seed more resistant to adverse conditions than the typical spore?
    7·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • What is unusual About Mitochondrial DNA ?
    11·2 answers
  • An autosomal recessive disease has an incidence of 1/10,000. What is the approximate frequency of heterozygote carriers for this
    9·1 answer
  • Which of the following best describes the fate of the cloned DNA used in a transformation experiment?
    12·1 answer
  • Which organ sterilizes ingested food?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!