2 years ago

which of the following planets has methane clouds in the atmosphere. Jupiter Mars mercury or Uranus

Biology

2 answers:

Ann [662]2 years ago

4 0

Answer:

The answer is B. Mars

Hope This Helped

-Dominant- [34]2 years ago

3 0

Answer:

Uranus.

Explanation:

Uranus is also known as ice giants and the seventh planet of the solar system. The north pole and south pole of Uranus lies near to the equator.

The internal heat of the Uranus is least among all the planets. The clouds of Uranus are sharp, light and made of different chemical compositions.Methane clouds of the Uranus lies in the troposphere layer.

Thus, the correct answer is Uranus.

You might be interested in

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

Organisms classified as fungi have unique characteristics. Which of the following characteristics is

svp [43]

Answer:

Fungi have multicellular filaments that absorb nutrients

Explanation:

5 0

2 years ago

Which criteria would Diabetes fall in?

igomit [66]

Answer:

I think it 2

Explanation:

bsmfoskrmxjsn nadmzmsl.xn see cmz.dnc se

5 0

3 years ago

During an epileptic seizure, the triggering of convulsions would not directly involve the uncontrolled activity of neurons locat

Olin [163]

The answer is: " thalamus " .
___________________________________________________________
"During an epileptic seizure, the triggering of convulsions would not directly involve the uncontrolled activity of neurons located in the  thalamus  ."
___________________________________________________________

8 0

2 years ago

The condition of the Rh factor is called ___when present and___ when absent. please help asap!

zepelin [54]

Answer:

Explanation:The condition of the Rh factor is called __RH positive_when present and__rh negative_ when absent.

4 0

2 years ago