1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
2 years ago
11

Why are the remains of rodenticides found in barn owls?​

Biology
1 answer:
lana [24]2 years ago
3 0

Answer: Poisoned Barn Owls can die slowly or live with a poison remnant in their body, according to research. After eating three mice carrying the toxin Brodifacoum, a Barn Owl usually dies in 6 to 17 days.

You might be interested in
How are consumers classified into different groups?
galina1969 [7]
Consumers are usually animals. Consumers cannot make their own food, so they have to eat other organisms. They can be classified into three main groups. These groups are herbivores, carnivores and omnivores.
3 0
4 years ago
Which of these does not add CO2 to the atmosphere?
Verizon [17]
C planting trees. It adds oxygen
7 0
3 years ago
Read 2 more answers
If I am in level virtuoso and I can send direct message but to whom I am sending has not completed that level. Then too will I b
PIT_PIT [208]

Answer:

Even if you aren't friends with that account, I believe they will be able to receive the message. :)

Explanation:

8 0
3 years ago
Read 2 more answers
The length of an axon is 10 mm, and its time constant is 4 msec. A voltage change at one end of the axon is 120 mV, which result
stich3 [128]

Answer:

what is the length constant of the neuron? = 4. 080791139mm

Explanation:

check the file below for explanation

8 0
3 years ago
It is forensic anthropoligy <br> pls help this is due tomorrow
sasho [114]
I’m sorry I do not know what the answer is. Are you in forensic science? I’m making my 4 year plan, and I put that as one of science classes. If you are in that high school class can you provide any details on that class. If you know the answer to their question and the second spot is full, please comment under my question for them.
5 0
3 years ago
Other questions:
  • Which of the following is a characteristic of alcoholic fermentation?
    6·2 answers
  • A client suffers from low mood and disturbed sleep. this client is most likely experiencing a change in which neurotransmitter?
    7·1 answer
  • A living microorganism or its toxin may cause human disease that is transported through the US MAIL MUST be marked as a:________
    6·1 answer
  • It is often easier to determine if an object or organism possesses the characteristics of life rather than life itself.
    7·1 answer
  • The bolus is liquefied in the ______ and it is now called chyme.
    15·1 answer
  • A scientist finds the bones of a dinosaur. what could help the scientist determine the approximate age of the dinosaur bones
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • _____________ are present in an organism, but they don't function in the same way they used to. HELP ILL GIVE BRAINLIEST!!! pict
    12·1 answer
  • Select all the kingdoms below that consist of prokaryotes:
    11·2 answers
  • Scientists have observed that in the Antarctic ecosystem Adélie and Chinstrap penguin populations have decreased in the past 40
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!