1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anton [14]
4 years ago
6

If B is the trait for brown eyes and b is the trait for blue, and a Homozygous Dominant dad and a homozygous recessive mom have

off-spring. How many of the F1 generation will be bb?
Biology
1 answer:
Inessa05 [86]4 years ago
3 0

Zero of the offspring will be bb.  Since each offspring receives one allele from each parent, all will receive a B from Dad and a b from Mom, making all of the offspring heterozygous (Bb) and brown-eyed.

You might be interested in
I am made of glyercol and fatty acid
Komok [63]

This is most definitely the definition for a Lipid!

3 0
3 years ago
Read 2 more answers
Do you think natural or synthetic resources are more important to our way of life? Justify your answer.
Alchen [17]

Answer:

no

Explanation:

synthetic folic acid is way more harmful then the natural folate in foods, it may build up in the body and raise cancer, and synthetic copies of natural chemicals are not as good for you

5 0
3 years ago
Read 2 more answers
25) Which statement describes asexual reproduction, but not sexual reproduction?
Schach [20]
Asexual is just another copy of the same organism. Sexual are two organisms to make another.
3 0
3 years ago
Read 2 more answers
Not all amino acids have to be supplied by food. this is true because:
vlabodo [156]
"<span>b. the liver is able to manufacture some amino acids from others."

The liver has the capability to transform some amino acids into others (called non-essential because they can be produced by the body and there is no need to get them from food). This is done by transamination. Transamination is the process of transferring an amino group from one molecule to another without forming ammonia thanks to enzymes that are called transaminases and preform such transfer.</span><span>
</span>
8 0
3 years ago
What type of graph is best used to represent trends in data
dybincka [34]

Answer: A line graph would be the best graph to show trends in data

Explanation:

4 0
3 years ago
Other questions:
  • To change behavior or actions in response to outside conditions 4 Letters. What is the word?
    5·1 answer
  • Which of the following statements explains why there is an elastic layer found in arteries, but not veins? The total length of a
    15·2 answers
  • Which of these is harmed by an ectoparasite in a parasitic relationship?
    14·2 answers
  • which of the following is a major form of animal communication? a. body language b. locomotion c. hoarding d. feeding
    5·2 answers
  • When a plant bends toward sunlight, the bending is an example of which characteristic of life?
    12·1 answer
  • Rheumatoid arthritis is an autoimmune disease in which the immune system becomes overactive and attacks the body’s own tissues.
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • There is the picture to the question
    5·1 answer
  • 1. For journalists, what is "citizen journalism" (also known as "collaborative journalism")?
    5·1 answer
  • CELL PROJECT BIOLOGY​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!