1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
2 years ago
13

Where in the human body are sperm cells produced?

Biology
2 answers:
maxonik [38]2 years ago
7 0
For males, they are produced in the Testes or male testicle.
kupik [55]2 years ago
7 0
They're created in the Testis
You might be interested in
Please answer each
nexus9112 [7]

Answer:

Function of each male reproductive system-

They produce, maintain and transport sperm and semen . They discharge sperm into the female reproductive tract. They produce and secrete male sex hormones.

Function of each female reproductive system-

The ovaries produce the egg cells, called the ova or oocytes. The oocytes are then transported to the fallopian tube where fertilization by a sperm may occur.

8 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
(IMPORTANT IN NEED OF HELP!!)
bija089 [108]

Clean or green energy helps in releasing lesser air pollution and lesser carbon dioxide. That contributes in lowing down global warming and subsequent disasters like tsunami because of glacier melting , more unexpected climate changes like unexpected long-period storms, flood, typhoons,  etc.

Hope this would help.

4 0
3 years ago
Explain why science is important to society
ratelena [41]

Answer:

Science is valued by society because the application of scientific knowledge helps to satisfy many basic human needs and improve living standards.

Explanation:

7 0
3 years ago
Which accurately describes gymnosperms? Select three options. Some of them lose their leaves in winter. Some of them lack seeds.
Ivahew [28]

Answer:

Some of them lose their leaves in the winter, they are the oldest type of seed plant, and they include the tallest type of seed plants

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following strands is the correct complement to the strand ATC-GTC-CCA
    10·2 answers
  • A scientific theory is a well-tested explanation for a wide range of observations or experimental results. A hypothesis is a pos
    13·1 answer
  • A nucleus contains DNA. During cell division they form tiny rod shaped bodies. What are they called?
    10·1 answer
  • Which of the following is not a piece of molecular evidence supporting the endosymbiotic theory?
    8·1 answer
  • BRAINLIESTTT ASAP!!
    11·1 answer
  • What adaptation most likely helps this bird fly?
    8·2 answers
  • Which are deuterostomes?<br><br>A. flowering plants <br>B. humans <br>C. fungi<br>D. slime molds​
    13·1 answer
  • What are the basic<br> Organs of respiratory system?
    14·2 answers
  • What does it mean for a membrane to be selectively permeable?
    8·2 answers
  • A student drew a representation of the atoms of a solid. The illustration shows closely packed atoms vibrating, but remaining in
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!