1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
10

The ______ system works with the circulatory system to maintain the correct water balance in cells.

Biology
2 answers:
love history [14]3 years ago
5 0

Answer:

Excretory system

Explanation:

One of the functions of the excretory system is to maintain the fluid balance of the cells. Kidneys serve the function by adjusting the concentration of urine in accordance with the water balance of the cell.

Under the conditions of dehydration or lower water levels in cells, concentration urine is produced by kidneys to prevent any further loss of water from the body.

Also, the absorption of electrolytes promotes the absorption of the water from the filtrate to produce concentration urine. On the other hand, increased fluid levels of the body are counterbalanced by the release of excess water from the body in the form of dilute urine.

lukranit [14]3 years ago
3 0
Most homeostatic regulation is controlled by the release of hormones (endocrine system) into the bloodstream (circulatory). However, other regulatory processes rely on simple diffusion to maintain a balance. 

<span>Homeostatic regulation extends far beyond the control of temperature (this would a combination of.the circulatory system and the skeletal muscle system) All animals also regulate their blood glucose, as well as the concentration of their blood (the circulatory, excretory, and endocrine systems all work together to accomplish this). Mammals regulate their blood glucose with insulin and glucagon. The human body maintains glucose levels constant most of the day, even after a 24-hour fast. Even during long periods of fasting, glucose levels are reduced only very slightly. Insulin, secreted by the beta cells of the pancreas, transports glucose to the body's cells, lowering blood glucose levels. Insulin helps to prevent hyperglycemia. When insulin is deficient or cells become resistant to it, diabetes occurs. Glucagon, secreted by the alpha cells of the pancreas, helps the body utilise stored glycogen or convert non-carbohydrate carbon sources to glucose via gluconeogenesis, thus preventing hypoglycemia. The kidneys are used to remove excess water and ions from the blood. These are then expelled as urine. The kidneys perform a vital role in homeostatic regulation in mammals, removing excess water, salt, and urea from the blood. These are the body's main waste products. </span>

<span>Sleep timing depends upon a balance between homeostatic sleep propensity, the need for sleep as a function of the amount of time elapsed since the last adequate sleep episode, and circadian rhythms that determine the ideal timing of a correctly structured and restorative sleep episode </span>


<span>The endocrine system is a system of glands, each of which secretes a type of hormone to regulate the body. The field of study that deals with disorders of endocrine glands is endocrinology, a branch of the wider field of internal medicine. The endocrine system is an information signal system much like the nervous system. Hormones regulate many functions of an organism, including mood, growth and development, tissue function, and metabolism. </span>


<span>The circulatory system is an organ system that passes nutrients (such as amino acids and electrolytes), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases and help stabilize body temperature and pH to maintain homeostasis. This system may be seen strictly as a blood distribution network, but some consider the circulatory system as composed of the cardiovascular system, which distributes blood, and the lymphatic system, which distributes lymph. While humans, as well as other vertebrates, have a closed cardiovascular system (meaning that the blood never leaves the network of arteries, veins and capillaries), some invertebrate groups have an open cardiovascular system. </span>


<span>The excretory system is a biological system that removes excess, unnecessary or dangerous materials from an organism. It is responsible for the elimination of oxygen waste products of metabolism as well as other nitrogeneous materials. Since the normal operation of most biological systems creates waste, the excretory system is not necessarily distinct from other systems. Instead, it often represents the various excretory processes of several different systems </span>

<span>The skin is another part of the excretory system: it releases sweat, which helps cool the body and regulate the concentration of salt. The salt helps the water evaporate, cooling off the skin. </span>

<span>The liver is an organ of the digestive system. It also helps in excreting wastes from the body in a variety of processes. Laboratory analysis reveals a high concentration of a small organelle called a peroxisome, responsible for breakdown of several toxic substances. It also takes in nitrogenous wastes and converts them to urea to reduce their toxicity. </span>

<span>In anatomy, the urinary bladder is the organ that collects urine excreted by the kidneys prior to disposal by urination. A hollow muscular, and distensible (or elastic) organ, the bladder sits on the pelvic floor. Urine enters the bladder via the ureters and exits via the urethra.</span>
You might be interested in
How do we use the Earth’s heat by capturing geothermal energy?
TEA [102]

Answer:People can capture geothermal energy through: Geothermal power plants, which use heat from deep inside the Earth to generate steam to make electricity. Geothermal heat pumps, which tap into heat close to the Earth's surface to heat water or provide heat for buildings. Dose this help?

Explanation:

7 0
3 years ago
A cross between two linked genes was done in coupling configuration and in repulsion. What is expected for the recombination fre
iren [92.7K]

A cross between two linked genes was done in coupling configuration and in repulsion. In coupling, the recombination frequency is greater than 1/16 and in repulsion, the recombination frequency is less than 1/16

If the cross between two linked genes is in coupling, then the recombination frequency is greater than 1/16 having the genotype aabb and phenotype ab.

If the cross between two linked genes is in repulsion, then the recombination frequency is less than 1/16 having the genotype aabb and phenotype ab.

Coupling is the gamete entered having genes from identical parents having same inheritance.

Repulsion is the gamete entered from different parents having separate inheritance.

Genes in coupling configuration on a homologous chromosome have two wild alleles and two mutant alleles on the other homologous chromosome.

Genes in repulsion configuration have a wild allele on one gene and the second gene on other homologous chromosome having a mutant allele.

Learn more about Homologous chromosome here, brainly.com/question/27258467

#SPJ4

8 0
2 years ago
Describe the structure of earth<br> paragraph form
Alexxx [7]

Answer:

​​The earth is made up of three different layers: the crust, the mantle and the core. This is the outside layer of the earth and is made of solid rock, mostly basalt and granite. Continental crust is less dense, thicker, and mainly composed of granite.

Explanation:

6 0
3 years ago
Which of these statements most accurately describes how carbon dioxide enters a leaf?
Whitepunk [10]
Carbon dioxide enters the leaf through openings usually found on the underside of the leaf called the stomata. Carbon dioxide passes through the stomata through diffusion, a passive process.
3 0
3 years ago
Which elements make up a water molecule?
oksano4ka [1.4K]

Answer:

D). hydrogen and oxygen

Explanation:

A water molecule consists of three atoms; an oxygen atom and two hydrogen atoms, which are bond together like little magnets. The atoms consist of matter that has a nucleus in the centre. The difference between atoms is expressed by atomic numbers.

6 0
3 years ago
Read 2 more answers
Other questions:
  • The process of photosynthesis is essential in the oxygen/carbon dioxide cycle. Photosynthesis removes ______ from the atmosphere
    12·2 answers
  • 1. A fossil is determined through radioactive dating to be 1.5 million years old. This is an example of *1 point
    13·2 answers
  • which tool enhances a scientist’s senses? a microscope a calculator a test tube a stirring stick
    9·2 answers
  • The [rungs] of the DNA ladder are made of
    14·1 answer
  • Which evolutionary adaptations health plan succeed in sprite on land
    11·1 answer
  • What do all of the organisms from the three domains have in common???
    10·1 answer
  • When does gametogenesis occur
    14·2 answers
  • Why does a mask have to cover both your nose and mouth to be effective explain using the Respiratory tract
    15·1 answer
  • What is the medullary index for an organism that has a medulla width of 2cm and hair shaft width 4cm? Is this organism human or
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!