The atmosphere
Is not a reservoir for phosphorus.
Answer:
from precipitation, oceans lakes streams and soil
Answer:
C) both an aggregate fruit and an accessory fruit
Explanation:
When several flower ovaries or receptacle of a flower with many separate carpels joins together they form aggregate fruit. Each ovary has a single ovule that converts into a seed after fertilization.
Aggregate fruit can be formed without the involvement of accessory parts called true aggregate fruit or with the involvement of additional floral parts called accessory aggregate fruit. Strawberry is also an accessory aggregate fruit because the different ovaries in the strawberry develops into achenes over the surface of flower receptacles.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
You may find them floating in the cytosol. These floating ribosomes make proteins that will be used inside the cell. Other ribosomes are found on the endoplasmic reticulum.