1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
4 years ago
6

What does the "T" in "killer-t-cells" stand for?

Biology
1 answer:
zubka84 [21]4 years ago
3 0
The T stands for Thymus.
Hope this helps!!
You might be interested in
Which statements about plant and animal cells is true?
erma4kov [3.2K]

Plants have a cell wall and chloroplasts; animal cells do not have either

Hope this helps : )

6 0
3 years ago
What makes up for an ideal cell?
SVEN [57.7K]

Answer:

Ideal cell is defined to be the cell will zero internal resistance.

4 0
3 years ago
How might targeting rapidly growing cells explain common chemotherapy side effects such as hair loss and nausea
IrinaVladis [17]

Cancer cells are the cells that divide rapidly than any other cells in the body. The drugs used in chemotherapy work on rapidly dividing cancer cells. Some cells of our body apart from cancer cells also divide rapidly along with the cancer cells such as the cells that line the stomach and the digestive tract. Chemotherapy drugs cannot differentiate the cancer cells and the normal cells so these drugs also attack the normal cells which divide rapidly along with the cancer cells. The drugs also attack the cells that are present in the roots of the hair. So, this results in the hair loss. Hair loss does not occur immediately after the chemotherapy treatment instead it starts after few treatments. The degree of the hair loss after chemotherapy depends on the drug type and process. So when the chemotherapy drugs are used it results in the hair loss and nausea.

Therefore, when chemotherapy drugs attack normal cells including the roots of the hair instead of cancer cells that divide rapidly along with the cancer cells it results in the hair loss and nausea.

3 0
3 years ago
Read 2 more answers
When you dig a water well for a house, you must pay per meter. Based on this image, how deep would you have to drill to reach an
Lerok [7]

14 is my best guess

6 0
3 years ago
Read 2 more answers
In ecosystems, plants transform light energy from the Sun into chemical energy when they make sugar. This sugar can then be cons
pav-90 [236]
The answer is D matter and energy shown in the question can change forms and is transferred to other locations for organisms to be used as building blocks for others.<span />
3 0
3 years ago
Read 2 more answers
Other questions:
  • Predict how unfavorable abiotic and biotic factors affect a species
    14·1 answer
  • PLEASE ANSWER ASAP CORRECTLY FOR BRAINLYEST!:) PLEASE AND THANK U:))
    7·1 answer
  • I’m kinda confused on this project, any examples? I don’t understand what I am doing at all.
    14·1 answer
  • Describe the different ways that the carbon cycle interacts with earth’s living organisms.(Name at least 2 ways.)
    13·1 answer
  • What are some chemical changes that happen in school?
    10·1 answer
  • 3. This helps to flavor food but too much can be harmful, especially to blood pressure.
    15·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
  • Marking people as brainlist:)
    5·2 answers
  • How do Newton's Laws apply to the way an object moves?
    12·1 answer
  • Please explain why the wind curves as it moves from high pressure to low pressure and if it causes
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!