1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Black_prince [1.1K]
3 years ago
10

______ is a source of genetic variation that involves the swapping of sections of chromosomes during meiosis.

Biology
2 answers:
Zepler [3.9K]3 years ago
7 0

Answer:

crossing over

Explanation:

This occurs between prophase 1 and metaphase 1.

OverLord2011 [107]3 years ago
6 0

Recombination is a source of genetic variation that involves the swapping of sections of chromosomes during meiosis.

<u>Explanation:</u>

Cell division is of 2 types one is the mitosis division of body cells and meiosis that is division of germ cell. The meiosis involves production of haploid gametes, these gametes fuse with each other and form a diploid zygote, and accordingly the formation of gametes involves the mixing of 2 different cells with homologous chromosomes.

Recombination is the result of crossing over of cells. When these cells fuse they give rise to a new gamete with characters mixed from both the cells.

You might be interested in
Why would a doctor suggest converging lenses to correct a patient’s vision?
irina1246 [14]
The correct answer would be D. because the patient's eyes have oddly shaped corneas. I really hope that this help's. I just moved to the U.S. so please dun't be mad at me if it's wrong.
7 0
3 years ago
Read 2 more answers
Which is an electromagnetic wave
KATRIN_1 [288]

Answer:

In physics, electromagnetic radiation (EM radiation or EMR) refers to the waves (or their quanta, photons) of the electromagnetic field, propagating (radiating) through space, carrying electromagnetic radiant energy. It includes radio waves, microwaves, infrared, (visible) light, ultraviolet, X-rays, and gamma rays.

Explanation:

If I understood the question.

3 0
3 years ago
In describe four features of bacteria that enable them to survive in a wide variety of habitats
ohaa [14]
<h2><u>Answer:</u></h2>

The 4 principle requirements for microorganisms survival are:

1) Food

2) Moisture

3) Warmth

4) Time

There are microscopic organisms that can develop in cold temperatures and some that blossom with warm temperatures.

A few bacteria go after the other microscopic organisms for survival. Different microscopic organisms get by getting supplements from dead items. Some microorganisms use photosynthesis to make their nourishment.

3 0
3 years ago
Read 2 more answers
Which two kinds of information describe weather and not climate?
Lapatulllka [165]

Answer:

b. the usual frequency of blizzards in an area

4 0
3 years ago
Read 2 more answers
What is a benefit of a nerve plexus? what is a benefit of a nerve plexus? they provide a straight path from the spinal cord to t
adelina 88 [10]
<span>Answer: they provide a straight path from the spinal cord to target muscles.</span>
4 0
3 years ago
Other questions:
  • A client asks the nurse about the use of an intrauterine device (iud) for contraception. which information should the nurse incl
    10·1 answer
  • Suppose a deposit of gold-containing rock was discovered, and geologists determined that the amount of gold in the rock was too
    9·1 answer
  • As of 2009, all living human beings have had their entire genome sequenced.
    6·1 answer
  • What are the limiting factors in a habitat
    8·1 answer
  •   A worm is living inside a cow and stealing nutrients from the cow's body, causing the cow to become malnourished. What type of
    6·2 answers
  • How are erosion and weathering alike
    6·2 answers
  • About how long did it take to grow the last 20 cells?
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Vocabulary: aerobic respiration, anaerobic respiration, ATP, cellular respiration, chlorophyll, chloroplast, cytoplasm, glucose,
    12·1 answer
  • Maggots get their energy by breaking down dead and decaying animals. What are maggots? autotrophs producers decomposers heterotr
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!