1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
11

What is the condition called where a proximal portion of the stomach pushes through an opening in the diaphragm

Biology
1 answer:
givi [52]3 years ago
6 0

Answer:

hiatal hernia

Explanation:

You might be interested in
What is the best definitionof chemical energy?
Sophie [7]
The answer would be a. Energy stored in chemical bonds :)
6 0
3 years ago
The major organ of the central nervous system, the brain, contains three distinct parts that each serve to control and coordinat
34kurt
Quick reactions/reflexes which do not need to be process by the brain in order to determine a response.
4 0
3 years ago
Read 2 more answers
BRAINLIESTTTT ASAP!<br><br> What challenges did the United States face during Reconstruction?
Svet_ta [14]
Outrage from the North because of the black codes that the South set.

I hope this helps!

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Dose having yeast infection make one feel pain during sex?​
S_A_V [24]

Answer:

Explanation:

Having sex with a yeast infection can be very painful or, at best, extremely uncomfortable. If your labia or vulva are swollen, you may find skin-to-skin contact to be too rough. Friction may even rub the skin raw. Penetration can aggravate inflamed tissue, as well as increase itching and irritation

3 0
3 years ago
Other questions:
  • The complete separation of a bone from its normal position in a joint is known as a
    7·1 answer
  • The small pieces of rock plus plant and animal pieces are called?
    6·2 answers
  • A codon is a sequence pf three nucleotide that codes for an amino acid. If the DNA sequence shown here goes through transcriptio
    10·1 answer
  • Hemoglobin is a(n) _______________-rich pigment that carries oxygen.
    14·1 answer
  • What activities are common to all living things
    13·1 answer
  • The tendency to view one’s own culture and group as superior is called
    8·2 answers
  • Scientists conduct investigations to answer questions. Before making a valid conclusion, scientists must-
    10·1 answer
  • In the case of a complaint of food-borne illness, the logs for temperature control must be made available to whom?
    7·1 answer
  • What do cells need to divide?​
    10·2 answers
  • Look at the picture<br>​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!