1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
3 years ago
14

Which of the following Mendel's laws best explains why the p generation produced two Black puppies​

Biology
2 answers:
Dmitry_Shevchenko [17]3 years ago
6 0

Answer:

Its Law of Segregation. Also please follow my instagram  The_official_unleashed

Explanation:

Ede4ka [16]3 years ago
5 0

Answer:

A)  

Law of Segregation

Explanation:

You might be interested in
A meteorite is determined to be 4.5 billion years old. It now has 78 atoms of lead-206. Assuming no loss of daughter isotopes, h
vovangra [49]
Given the age of the meteorite is 4.5 billion years old with 78 atoms of lead-206 the answer should be B. 156. The half-life of uranium-238 in order to decay into lead-206 is 4.46 billion years, which means that the original number of atoms is 156.  
6 0
4 years ago
How to avoid wastage of food?
andre [41]
To avoid just don’t make too many food and make how much you can eat
3 0
3 years ago
Read 2 more answers
HURRYY!!<br><br> Why have American's portion sizes become larger in the last decade?
Viefleur [7K]

Answer:

American's portion sizes have become larger in the last decade due to the expanding of food industries and marketing campaigns that tell us to eat more.

Explanation:

The growth of food industries in the last decades to obtain more money in combination with the media influence has led us to eat more, thus why the size of our portions has increased their size.

Another theory states that people always want to eat more, and the industry has only fulfilled this demand, but it is not clear why, in the past, this did not happen.

8 0
3 years ago
Answer the following questions based on the graph just completed.
arsen [322]

Answer:

2. Depth 3. Number of bubbles

Explanation:

2. Depth

3. Number of bubbles

4 0
3 years ago
How can we get bacteria off of us
WITCHER [35]

Answer:

by washing ourselves with soap

7 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do cells acquire homologous chromosome pairs that carry the alleles that are independently assorted?
    7·1 answer
  • What is a jet stream?
    12·2 answers
  • Phagocytosis is a process that most likely results in question 1 options:
    5·1 answer
  • What is the name for the compound with the formula F
    5·1 answer
  • This paragraph attempts to explain the rain shadow effect, but it gets some of the facts wrong. Identify the inaccurate statemen
    9·2 answers
  • An allogenic skin graft allows a person with a burn to receive skin from a donor. Patients are often given drugs to suppress the
    7·2 answers
  • Why do we use cell transport
    6·2 answers
  • A scientist discovered a new bird species. It has a long, pointed beak and long legs without feathers. For which habitat is this
    10·2 answers
  • Label this diagram with these 4 words
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!