1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laila [671]
3 years ago
8

You just saw bees flying in and out of a hole in a old tree. You know it's not a good idea to get too close. So, how can you fin

d out what bees do indisde a free? What research resource would you go to first? Explain why. HOw can you find out what bees do inside a tree?
Biology
1 answer:
Serggg [28]3 years ago
4 0
I would go to technology resource first because technology is everywhere in your home, libraries, etc. You can find out what bees do in trees by researching your answer on a search engine and going on trusted websites.
You might be interested in
You are examining another neuron, and find that it has two processes, both of which generate action potentials. What is the stru
Nitella [24]

Answer: This is a pseudounipolar neuron.

Explanation: A pseudounipolar neuron has two axons, a central process and a peripheral process. Both processes are capable of generating action potentials, and so both are axons.

3 0
3 years ago
Read 2 more answers
Which is true of genes? Question 4 options: They are proteins that produce sections of DNA which control the cell's activities.
OleMash [197]

The fundamental and functioning unit of genetics is called genes. They are units of DNA that produce proteins that control the characteristics of organisms.

<h3>What is the role of genes?</h3>

Genes are the basic and fundamental of inheritance and are made up of deoxyribonucleic acid. The variation of the gene of the same trait forms the alleles.

They code for the proteins that produce protein or RNA structures. Genes are located on the chromosome structure and code for proteins that play an important function and role in cell activity.

Therefore, option D. genes are a section of DNA that codes for proteins is correct.

Learn more about genes here:

brainly.com/question/787658

8 0
1 year ago
How can you lift an elephant with one hand? <br> If you can answer this you can be the brainliest!
Nina [5.8K]

Answer:

By letting the elephant lift you hand?!!

Explanation:

I have no idea

BUT......

Please mark BRAINLIEST!!!!

3 0
3 years ago
Read 2 more answers
Knowing that some individuals from Island 1 colonized Island 2, biologists sample the Mainland and two Island populations fifty
raketka [301]

Answer:

The evolutionary mechanism that could be influencing the allele frequencies between both islands and the mainland population might be Founder Effect.

Explanation:

Genetic drift is the random change that occurs in the allelic frequency of a population through generations. The magnitude of this change is inversely related to the size of the original population. These changes produced by genetic drift accumulate in time and eventually, some alleles get lost, while some others might set. Genetic drift affects a population and reduces its size dramatically due to a disaster -bottleneck effect- or because of a population split -founder effect-. In <u>founder effect</u>, a new population originates when a few individuals who are coming from a bigger population carrying its genes, settle down in a new area and reproduce. This small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be completely lost. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, <u>genetic variability is reduced</u> and there exists the possibility of developing a peculiar allelic composition. If the number of individuals that originated the new population is low, the founder effect will be very extreme, because the effects of the genetic drift are inversely proportional to the original number of individuals.  

<em>In the exposed situation, the evolutionary mechanism that could be influencing the allele frequencies between both islands and the mainland population might be Founder Effect. The fact that both islands are similar in their frequencies might be due to little genetic variation on island 1, or because dispersion to island 2 is a recent event on time. </em>

5 0
2 years ago
In class, your professor shows you the skulls of three mammals. In one, the eye would be fully enclosed by bone. In the second,
zheka24 [161]

Answer:

C

Explanation:

It is more probable that the third one has a more developed sense of the vision with a large eye, and its movements. Also with a opened back to receive its nutrition and optic nerve.

Sources:

Zihlman, Adrienne. (2006). «The Ape in the Tree». International Journal of Primatology (en inglés) 27 (4): 1227-1228

8 0
3 years ago
Other questions:
  • Why should GMOs be label
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is the name of the first amino acid you dragged into place using the Universal Genetic Code chart?
    10·1 answer
  • In pea plants, the allele for tallness (T) is dominant over the allele for shortness (t). If two tall pea plants are crossed, ca
    5·1 answer
  • What is the heat of the sun
    11·1 answer
  • 7. Dual purpose breed of goat-<br>(A) Barbari (B) Jamnapari<br>(C) Marwari (D) Beetul​
    5·1 answer
  • Describe in detail the lifecycle of Cryptosporidium.
    10·1 answer
  • What genetic and other changes might have caused these cells to escape normal cell cycle regulation these cells are hela cancer
    6·1 answer
  • Give an example of a specific joint in the human skeletal system.<br> Please help
    15·2 answers
  • Whats the main benefit of genetic biodiversity​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!