1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seraphim [82]
3 years ago
9

Which component of a Milankovitch cycle is related to periodic ice ages throughout Earth's history? A. Axial precession B. Apsid

al precession C. Cloud cover feedback D. Precession of the ecliptic
Biology
2 answers:
Dafna1 [17]3 years ago
5 0

Answer:

I just took the test the answer is Apsidal precession.

Leviafan [203]3 years ago
3 0

The answer is c because the precession of the ecliptic was component of a milankovitch cycle  and is related to periodic ice ages through out history

You might be interested in
Compare and contrast Rotation and revolution
Karo-lina-s [1.5K]
Rotation is the spinning of a planet, revolution is when a planet circles the sun/planet.
5 0
3 years ago
Fertilizer grade is the relative _________ in a bag of fertilizer.
Ivenika [448]

Answer:

proportionhejenrn4nrrh4htj

8 0
3 years ago
Do we have 23 or 46 chromosomes​
AleksAgata [21]

46 chromosomes, but 23 pairs.

5 0
3 years ago
Read 2 more answers
2. Why are there so many small faults in the San Francisco Bay Area?
ra1l [238]
I believe it’s because of San Andreas fault line if that helps
8 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • What are 4 effects of global warming
    9·1 answer
  • Imagine a world in which all the elements
    8·1 answer
  • How do channel proteins assist cells in the process of diffusion
    11·1 answer
  • What is the variable a scientist changes on purpose?
    7·1 answer
  • When the immune system attacks the body`s own cells, it produces an _________. disease.
    8·1 answer
  • What are made in the light reactions of photosynthesis?
    5·2 answers
  • Imagine you are sitting with your leg at rest and free to move in all directions. An experimenter inserts an electrode into a mu
    14·1 answer
  • The largest buttock muscle<br> a. Gluteus maximus<br> b. Tibialis anterior
    9·1 answer
  • Carbon naturally moves through ecosystems. however, human activities over time have been impacting the carbon cycle and causing
    8·1 answer
  • Compare fermentation to the way your body feels when you are<br> exercising.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!