1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
14

In environments that lack oxygen, some organisms have developed a way to break down intorganic molecules in order to produce ene

rgy. What is this process called?
Biology
1 answer:
Ierofanga [76]3 years ago
8 0

The above mentioned process is called as <u>Anaerobic respiration </u>

<u>Explanation:</u>

All organisms need oxygen to produce energy but in some prokaryotes and eukaryotes they lack the presence of oxygen in their environment. Hence they have adapted a strategy called anaerobic respiration to break down the inorganic molecules to produce energy.

They use carbon dioxide and release methane as the by product. The process of glycolosis helps.  All types of fermentation happens anaerobically here. It helps down to break down the fuels and produce energy. This energy is utilized for their life function.  

You might be interested in
What goes with it ?
cricket20 [7]

Photosynthesis does all those things. Releases energy in the form of ATP, stores energy in glucose molecules, performed by producers, and performed by consumers.

3 0
3 years ago
Read 2 more answers
How do humans differ from chimpanzees?
Marta_Voda [28]
They walk on all fours , they can’t swim , shorter lifespan, extra chromosomes
4 0
2 years ago
Read 2 more answers
Describe the process in which trees communicate with one another
olya-2409 [2.1K]

Answer:

Trees share water and nutrients through the networks, and also use them to communicate. They send distress signals about drought and disease, for example, or insect attacks, and other trees alter their behavior when they receive these messages.

8 0
2 years ago
21. Which step in cellular respiration occurs outside of the inner membrane space of the cell mitochondria? a. Krebs Cycle c. Tr
Marrrta [24]

Answer: c. Transition Reaction

Explanation:

During the transition reaction, Acetyl-CoA is formed and connects the first stage of glycolysis with the Krebs Cycle (Citric Acid Cycle). In the presence of oxygen, pyruvate enters the mitochondria and is oxidized to form a compound of 2 carbon, acetate, with energy and CO2 release. During this process, the acetate binds to a coenzyme(coenzyme A (CoA)) - forming the acetyl-coenzyme A.

The 3 steps:

1. pyruvate is oxidized and forms acetate with liberation of CO2;

2. the energy released in the oxidation of pyruvate is stored in the reduction reaction of NAD+ to NADH + H+

3. The acetate molecule combines with coenzyme A to form acetyl-coenzyme A.

3 0
3 years ago
1) What surface characteristics affect the rate of heating and cooling?
matrenka [14]

Answer:

The color of the surfaces because an object with a black surface will absorb and reradiate energy faster and at a higher concentration than the same object with a lighter colored surface.

7 0
3 years ago
Other questions:
  • How can the carrying capacity for a population decrease?
    10·1 answer
  • This is an organism that obtains its energy from inorganic substances or from the sun.
    8·1 answer
  • Which would least likely be seen om an information pamphlet for red tide?
    7·2 answers
  • The condition known as _____ is characterized by the abnormal enlargement of the hands and feet.​
    13·2 answers
  • Matching/Sequencing Activity: Maslow's Hlerarchy of Needs
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Need help ASAP!!
    13·2 answers
  • Can someone help me??
    8·1 answer
  • What differences would you expect to observe between an igneous intrusion into sedimentary rock and an igneous rock where sedime
    14·1 answer
  • What differentiates an autonomic reflex from a somatic reflex? a single sensory neuron in the sensory pathway
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!