1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
10

Phosphorus cycles between living things and

Biology
1 answer:
Zepler [3.9K]3 years ago
8 0

Answer:

The Environment

Explanation:

particularly the soil. This is the case with many other substances as well such as carbon. The cycling occurs due to the action of organisms which uptake and release phosphorus into the soil.

plz mark me as brainliest :)

You might be interested in
Which type of gene therapy results in alteration of the DNA of a gamete or a fertilized ovum?
larisa86 [58]

Answer:

The correct option is: <u>e. Germline gene therapy</u>

Explanation:

The <u>germline gene therapy</u>, GGT is the <u>modification of the germ cells</u>. In this therapy, a functional gene is introduced into the genomes of the gametes. Such a modification of the germ cell results in all the cells of the organisms to get modified. This change can therefore be <u>passed on to the next generations.</u> Many countries such as Canada, Germany and Switzerland, have prohibited the use of the germline gene therapy on humans.

7 0
4 years ago
Please help with science biology ASAP!! Will give brainliest!
Volgvan

Answer:

1) The beaks are different because they each had different purposes, such as the types of seeds the birds eat.

2) Natural selection is that organisms that are better suited for they're environment survive and reproduce.

3) Variation is the differences of one organism's difference from another of the same organism.

4) Biased off the fossils scientist may see the changes that happen over time to them and thanks to the ability of seeing how old a fossil is we may better order them.

5) Mimicry is when one organism "mimics" another, whereas camouflage is when one organism changes to look likes it surroundings.

6) Adaptation is a change or the process of change of which an organism or species becomes better suited to its environment.

7) An endangered species is a species that is very low is sightings or near extinction.

8) A herbivore has a plant biased diet whereas a carnivore has a meat, or other living organism biased diet.

9) Flowers use coloration to use a color to attract birds, and insects to reproduce and pollenate.

10) Charles Darwin was a explorer and scientist that came up with the theory of evolution, which states that through natural selection a species may change, give rise to new species, with a common ancestor.

Explanation:

Wow this took a while.

7 0
3 years ago
Read 2 more answers
A tentative explanation based on observation is referred to as a hypothesis.
Leto [7]
The answer is: a. true
5 0
2 years ago
How does land development damage ecosystems
barxatty [35]

Answer:

the answer is: it increases human carrying capacity too rapidly, it converts them into residential or agricultural areas, and it forces humans to import non-native plants and animals

3 0
3 years ago
Which of the following terms describes a space object that lands on Earth? (2 points)
Pie

Answer:

Your answer is meteorite, because it survives the pressure from the atmosphere so it can land on earth without being destroyed.

Explanation:

5 0
3 years ago
Other questions:
  • What kind of stem cells are skin stem cells?
    15·2 answers
  • What sorts of genetically engineered technologies are individuals allowed to copyright?
    6·1 answer
  • Story mode for pencil
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Explain the relationship between these terms. photosynthesis chlorophyll thylakoids chloroplasts
    15·2 answers
  • You are called to a shopping center for a "man-down-unknown cause. " Upon arrival you find an unconscious man who appears to be
    10·1 answer
  • How do dolphins maintain homeostasis? I need someone to answer my question for biology I need help.
    7·1 answer
  • Why anatomical and molecular features often fit a similar nested pattern.in addition descibe a orocess that can cause this not t
    13·2 answers
  • Humans affect the carbon cycle in many ways through the use of fossil fuels clear cutting of forests and controlled burns which
    10·1 answer
  • The kidney is enclosed in a membrane called:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!