1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

M’s insurance company denied a reinstatement application for her lapsed health insurance policy. The company did not notify M of

this denial. How many days from the reinstatement application date does the insurance company have to notify M of the denial before the policy will be automatically placed back in force?
Health
1 answer:
strojnjashka [21]3 years ago
8 0

Answer:

Forty days.

Explanation:

Health insurance may be defined as the insurance that covers the partial or whole risk of the person includes the medical expenses. The health care risk are covered in the insurance policy.

M's insurance company denies the reinstatement application for her lapsed health insurance policy. In this case the company can notify the denial within the forty days. This is the rule according to the U.S. health insurance policy to notify the denial within 40 days.

Thus, the answer is 40 days.

You might be interested in
What do you think about the process by which such things as hyperactivity and obesity are now seen as medical conditions as oppo
dmitriy555 [2]

Answer:

Obesity is excess weight, defined as a body mass index (BMI) ≥30 kg/m2. Complications include cardiovascular disorders (especially in people with excess belly fat), diabetes, certain cancers, gallstone disease, fatty liver, cirrhosis, degenerative joint disease, and reproductive disorders. in men and women, psychological distress, and premature death for those with BMI ≥ 35. Diagnosis is based on body mass index. Treatment includes lifestyle changes (eg, in diet, physical activity, and behavior), and, for some patients, medications or weight loss surgery (weight loss).

So it's a disease, not a behavioral problem

8 0
3 years ago
In what stage is an ulcer when the skin appears red and irritated?
nikitadnepr [17]
The answer is stage 1
8 0
3 years ago
The pituitary gland in a male child is malfunctioning. It signals the reproductive organs to secrete hormones too early. Based o
lana66690 [7]

Answer:

This impact could be early puberty some examples are early growth such as height and his body parts, he would probably get really hXrny easily (turned on/ aroused), and the numbers/measure of his sperm would increase.

Explanation:

7 0
3 years ago
Read 2 more answers
What is the center of hair known as?
guapka [62]
Uuuiiiiiiuhuuuuuuuu7uuyruurvr7rvufbrufbufbfifbt
4 0
3 years ago
Read 2 more answers
The wound care nurse evaluates a client's wound after being consulted. the client's wound healing has been slow. upon assessment
Virty [35]

Answer:

Desiccation

Explanation:

Skin healing involves a huge range of events and special situations. It consists of a perfect and coordinated cascade of cellular and molecular events that interact for repaving and tissue reconstitution. With all the other metabolic processes in the body, healing depends largely on the degree of hydration the individual's body is. In cases of dehydration, desiccation may occur, which is localized dehydration of a wound, which consists of slow healing and scabbing of the wound tissues.

5 0
3 years ago
Other questions:
  • Explain how eating fruits and vegetables to support dietary fiber intake can help with hydration and immune function.
    15·1 answer
  • What would u do if ur baby had downsyndrome
    10·2 answers
  • A registered nurse teaches a nursing student about the effects of aspirin in pregnant women. Which statement made by the nursing
    14·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • Steroid use can have several physical consequences. What effect can the use of steroids have on men?
    11·1 answer
  • Heyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy
    14·1 answer
  • Que compromisos familiares se pueden hacer para disminuir la contaminación<br>​
    7·1 answer
  • Oxygen and carbon dioxide exchange in order to keep our bodies healthy during an
    10·1 answer
  • Plyometric exercises involve __________. A. Eccentric muscle loading and concentric contraction B. Concentric muscle loading and
    15·2 answers
  • Sports drinks are just as good for you as water. true false
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!