1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
12

In the 1800s, scientists studied how fat-soluble substances and water-soluble substances interact with cell membranes. Their stu

dies provided
evidence that cell membranes are structured to perform certain functions. What function did these studies suggest that cell membranes
perform?
carry materials throughout the interior of the cell
control the cell's activities
control which substances enter the cell
form proteins from fat-soluble substances
Biology
1 answer:
Readme [11.4K]3 years ago
5 0

Answer:

control which substances enter the cell

Explanation:

According to this question, scientists in year 1800s studied how fat-soluble substances and water-soluble substances interact with cell membranes. Cell membrane is a cellular structure found in every living cell whose function is to demarcate the interior of the cell from the external environment.

Based on the study, cell membrane interacts with water-soluble and fat-soluble substances in order to control which substances can enter the cell. The cell membrane is selectively permeable meaning that not all substances passes through it into and out of the cell.

You might be interested in
Sort the following list into the table below
STatiana [176]

Answer:

<u>Abiotic</u>: Clouds, rocks, wind, temperature, ocean currents, sunlight, topograhy, precipitation, air quality, soil, water, humidity, climate.

<u>Biotic</u>: Grass, wolves, fish, microbes, insects, trees, birds, moss, animals, bacteria, organic matter, plants.

Explanation:

Biotic factors are things that are or were once living. Abiotic factors are things that are not and never were living.

3 0
3 years ago
Read 2 more answers
Choose the total number of each item requested below. 4C 6 H 12 O 6 A.Carbon atoms B.Hydrogen atoms C.Oxygen atoms Molecules
enyata [817]
A. Carbon is represented by 2C. thus there are 4 Carbon atoms.
using the same method here are the other answers.
B. 6
C. 12
Now. there is only one molecule because 4C6H12O is the element count of a molecule.
6 0
4 years ago
Read 2 more answers
GIVING OUT BRAINLIEST
Slav-nsk [51]
Probably A the average amount of rain
3 0
3 years ago
If you boil an egg for lunch, the egg white becomes hard, white, and opaque because the protein molecules have unfolded, causing
xeze [42]
This is an example of how heat denatures a protein
3 0
4 years ago
Will give you brainlit
12345 [234]

Answer:

i want brainiest pls

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • What property of water provides for appropriate sugar, salt, and amino acid levels to be present and carried in the blood of ani
    5·2 answers
  • Help...........!!!!!!!
    6·1 answer
  • How are earthquakes and volcanoes similar or related and how are they different? please help essay due tomorrow
    13·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • How do you closed digestive systems differ from open digestive systems?
    14·1 answer
  • Why would someone get tested for hemophilia
    9·1 answer
  • A molecule that has one atom in its particles and formula *
    11·2 answers
  • Which technology is used on farms to increase food production for the
    14·1 answer
  • Name every "thing" On this planet.
    14·2 answers
  • Which form of early photosynthetic life consumed much of the CO₂ in Earth's atmosphere, allowing life to become possible?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!