1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
12

Bacteria lack RNA-splicing machinery, which means they are unable to splice out introns from eukaryotic genes. To engineer a bac

terium to produce a eukaryotic protein, it is necessary to synthesize a gene without introns. If you know the nucleotide sequence, you can _____.
Biology
1 answer:
taurus [48]3 years ago
8 0

Answer:

<em>make a gene from the given mRNA without the introns.</em>

Explanation:

Introns can be described as the non- coding regions of DNA. As they are non- coding, they are spliced out from the mRNA so that only the coding regions can be translated.

If we know a nucleotide sequence, then we can make a gene from it without added the introns. We can consider an mRNA strand and make a complementary strand from it, excluding the intron regions. Then from the DNA produced, we can make an mRNA without the introns and insert it into a bacterium.

You might be interested in
A theory of evolution that states that a species evolves in spurts of rapid change and then goes through periods of no change is
Aleksandr-060686 [28]
A theory of evolution that states that a species evolves in spurts of rapid change and then goes through periods of no change is known as <span>punctuated equilibrium.</span>
8 0
3 years ago
Select all that apply. Ecosystems _____.
Agata [3.3K]

Answer:

all of them apply

Explanation:

In my opinion all of them apply (except the 4th one). Ecosystems can be small, big, have living and non-living parts and they are made of biomes. Not only can ecosystems vary in size, but they can also differ in just about every imaginable biotic or abiotic feature.

5 0
3 years ago
Read 2 more answers
What are some factors that can increase or decrease the heart rate and the beat you feel at each pulse point?
Amanda [17]
One factor is resting and exercising
stress and peace
4 0
3 years ago
A mating between a male donkey (2n = 62) and a female horse (2n = 64) produces sterile mules. why are mules sterile?
kirza4 [7]

The horse and donkey, though closely related by sharing a common ancestor, are different species. They have different number of chromosomes hence pairing of homologous chromosomes during fusion of gametes becomes complicated. The mule will have an extra chromosome from the horse hence will have abnormalities such as sterility. A Mule is unable to reproduce due to this same phenomenon. Homologous chromosomes are not well paired for meiosis I.






6 0
3 years ago
1. When you look out the window, you can see constantly moving air. Air is cycled in order to reach equilibrium. (18 points)
boyakko [2]

Answer:

i think its 2 i am nottttt sureeee

4 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Does the cell cycle have a beginning and an end
    5·1 answer
  • What will happen to the universe billions of years from now?
    6·2 answers
  • What is the long term and short term goal of every organism?
    15·1 answer
  • Define the term postpurchase cognitive dissonance and give an example of when this happened to you. Then explain what the compan
    13·1 answer
  • If the nucleotides 5'-GAT-3' are paired with the nucleotides 3'-CUA-5', the pairing must be __________.
    11·1 answer
  • a mutation in a triplet code that ends up coding for the same amino acid is referred to as a silent mutation. in what sense is i
    15·1 answer
  • The two members used in the construction of an aircraft fuselage are joined together using a 30° fish-mouth weld. Determine the
    15·1 answer
  • Explain why only certain substrate can combine with enzymes.<br>Help me please​
    5·1 answer
  • The major sources of vitamin A are___,___,___&amp;____​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!