1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvv77 [185]
3 years ago
7

What is the difference between chromosome number and ploidy?

Biology
1 answer:
lubasha [3.4K]3 years ago
8 0

Answer

The difference found between haploid and diploid.

You might be interested in
What does the air mass property cA mean
GenaCL600 [577]

Answer:

The source regions of the world's principal air masses: continental Arctic (cA), continental polar (cP), continental tropical (cT), maritime polar (mP), maritime tropical (mT), and maritime equatorial (mE).

4 0
3 years ago
bachiko congratulated her staff when the team received an industry award for their project, and also sent a companywide e-mail a
trapecia [35]

Bachiko congratulated her staff when the team received an industry award for their project, and also sent a companywide e-mail announcing it. here, Bachiko is using her <u>personalized</u> power.

In the example above, Bachiko is using his power. Personalized power is the power in which a person has a superiority complex and thinks that he is superior to others. Also, he made sure that people knew that he was someone else's boss.

The sources of management power are as follows:

Positional power

  • strength because of the award/prize.
  • power because you have a certain authority.
  • power because of the punishment given.

Personal power

  • power because you have certain knowledge and abilities.
  • power because of your attractive personality.

Learn more about personal power at brainly.com/question/11656512

#SPJ4

8 0
1 year ago
Pls help me guys! Super hard
babunello [35]
I think the answer is c
8 0
3 years ago
A change in biological or physical conditions that upsets the balance of an ecosystem is called a/an
Reptile [31]
Disruption

I hope this helps (:
6 0
3 years ago
The picture shows an interaction within an environment.
Ivan

Answer:

The answer is biotic and interacting with an abiotic factor.

Explanation:

In the picture there is a tree and it is raining and rain is abiotic since it is not alive and the tree is biotic so the answer is the 4th choice.

4 0
3 years ago
Other questions:
  • If you were looking at a slide from some pond water and you observed a single celled organism that was green in color but also c
    12·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Intense heat and pressure from below the earth surface forms this type of rock
    10·1 answer
  • Which mineral forms through sedimentary processes
    5·1 answer
  • PLEASE HELP!!!!!!! Please just give your best answer. It doesn’t need to be long or explained. I JUST NEED AN ANSWER!!!!!!!
    7·1 answer
  • 19. Why are biologists uncertain about how many species are living on Earth?
    13·1 answer
  • An example of super volcano is <br><br> Red stone<br><br> Yellowstone <br><br> Bluestone
    8·2 answers
  • In the F1 generation of a Mendelian cross,
    15·2 answers
  • Can a cell live without nucleus?​
    8·1 answer
  • 1. During exercise, the amount of blood that returns to the heart increases dramatically. What change (if any) can be predicted
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!