1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastova [34]
3 years ago
12

If someone could help explain how to solve this

Biology
1 answer:
Mnenie [13.5K]3 years ago
5 0

Answer:

200 meters

Explanation:

A kilometer is 1,000 meter. 0.2 x 1,000 is 200 meters.

You can also think of it this way, 0.2 is 1/5. We need to find 1/5 of a kilometer. We know the conversion is 1,000 meters/kilometer. 1,000/5 is 200. Therefore you must walk 200 meters to hatch the egg.

You might be interested in
Which of the following objects would experience the greatest acceleration if the same unbalanced force were applied to each?
REY [17]

Answer:

A=An object of mass 1 kg

Explanation:

3 0
3 years ago
NADH is also used by cells when making certain molecules. Based on your knowledge of the role of NADH in cellular respiration, w
chubhunter [2.5K]

Answer:

b. reducing molecules

Explanation:

Nicotinamide adenine dinucleotide (abbreviated NAD +, and also called diphosphopyridine nucleotide and Coenzyme I), is a coenzyme found in all living cells. The compound is a dinucleotide, as it consists of two nucleotides linked through their phosphate groups with a nucleotide that contains an adenosine ring and the other that contains nicotinamide.

In metabolism, NAD + participates in redox reactions (oxidoreduction), carrying electrons from one reaction to another.

Coenzyme, therefore, is found in two forms in cells: NAD + and NADH. NAD +, which is an oxidizing agent, accepts electrons from other molecules and becomes reduced, forming NADH, which can then be used as a reducing agent to donate electrons. These electron transfer reactions are the main function of NAD +. However, it is also used in other cellular processes, especially as a substrate for enzymes that add or remove chemical groups of proteins, in post-translational modifications. Due to the importance of these functions, the enzymes involved in the metabolism of NAD + are targets for drug discovery.

5 0
3 years ago
Which term defines a well-tested, scientifically supported statement that explains how something works? A. hypothesis B. law C.
pshichka [43]

Answer:

I think it's (D)... But I'm not sure

7 0
3 years ago
Read 2 more answers
Which animal adaptation would be best for this habitat?
Kruka [31]

Answer:

B an animal that can live in fresh water

6 0
3 years ago
Read 2 more answers
Which best describes the fossil record?
Sonbull [250]

The correct answer choice is answer B.) The fossil record provides evidence of a common ancestor to many species. Hope this helped!

7 0
3 years ago
Read 2 more answers
Other questions:
  • What atoms are present in each type of molecule
    9·1 answer
  • Emily and Zach are two students working in the lab to improve the stability and activity of the newly discovered transport prote
    8·1 answer
  • At the bottom of the energy pyramid you will find ____ (autotrophs, herbivores, canivores, or top carnivores). An example of thi
    6·1 answer
  • What is meant by the term thermal inversion?what causes this to occur?
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Help please show work
    8·2 answers
  • 2. What does letter B represent on the Earthquake model?
    14·1 answer
  • It is possible to experience a solar eclipse during a full moon. Question 3 options: True False
    6·1 answer
  • Which options are examples of innovations that increased the carrying capacity of Earth for people? THANKS!
    13·1 answer
  • If the specific gravity of urine is 1. 020 in the sample of urine, what caused the filtrate to increase its s. g. between bowman
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!