1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
3 years ago
6

Archaea have cell walls made of peptidoglycan. a. True b. False

Biology
1 answer:
Svetradugi [14.3K]3 years ago
5 0

Answer:

False.

Explanation:

Three domains of life are bacteria, eukarya and archaea. The prokaryotic organisms are involved in the bacteria and archaea. Eukaryotic organisms are included in the domain eukarya.

The archaea are more similar to eukarya than bacteria. The cell walls of the archaea are made of glycerol-ether lipids. The phospholipids of archaea are built on a backbone of sn-glycerol-1-phosphate. Archaea lacks the peptidoglycan layer in its cell wall.

Thus, the answer is false.

You might be interested in
PLEASE HELP I AM TIMEDD!!!!
liberstina [14]

Answer:

density

Explanation:

6 0
3 years ago
One species evolves over millions of years to become two different but closely related species
marishachu [46]
I think the answer is apes/monkeys are closely related with humans.
3 0
4 years ago
Standing in the elevator, someone sneezes on you infecting you with a new rhinovirus. However, it then takes 3-6 days until you
Anit [1.1K]

After six to eight days, the adaptive immune response begins and is specific to the infection. It involves two types of white blood cells: T cells (cellular response) and B cells (antibody response).

Generic reaction to ANY infection; Innate immune response cells generate interferons1 and other substances (cytokines); Interferons prevent virus reproduction; Phase 2 is triggered; Innate immune response.

The body's defense against viral infections

At this stage, infection in phases one and two can be stopped.

1. The early signs of infection, such as fever and muscular pains, are brought on by interferons and cytokines.

2. The adaptive response could not be stimulated right away if the innate reaction is "weaker" in some individuals (such as the elderly or those with underlying health issues).

Learn more about cytokines brainly.com/question/23075811

#SPJ4

7 0
2 years ago
The arbitrary and capricious test is very well defined.<br> a. true <br> b. false
Furkat [3]
False.
The definition of Arbitrary and Capricious is:
A clear error of judgment; an action not based upon consideration of relevant factors and so is arbitrary<span>, </span>capricious<span>, an abuse of discretion or otherwise not in accordance with law or if it was taken without observance of procedure required by law. 5 USC. 706(2)(A) (1988).
</span>
What is arbitrary to one can be perfectly sane to another one hence the statement is false.
8 0
4 years ago
Which cell structure physically moves the cell's chromosomes?
Kobotan [32]

The answer to this question is the mitotic spindle. The mitotic spindle is also called as the spindle fibers. Mitotic spindle is a structure of eukaryotic cells that are formed during cell division wherein the parent cells are divided into more cells. Components of mitotic spindle consist of large number of proteins.  

3 0
4 years ago
Other questions:
  • What was changed in the "Viscosity" lab?
    7·2 answers
  • The salinity in salt marshes can vary throughout the day because _______.
    5·1 answer
  • The process by which a cell engulfs a foreign particle is known as:
    14·1 answer
  • The agent of erosion that makes a rock fall from high places is water wind ice gravity
    5·1 answer
  • During gastrulation,two openings form in most animals.If the first opening becomes the mouth, the animal is
    8·1 answer
  • _______________ produce proteins by following coded instructions that come from the nucleus of the cell. A) Actins B) Flagella C
    8·2 answers
  • Why are olive ridley turtles vulnerable?
    12·1 answer
  • why is it important to have all parts of a graph clearly labeled and drawn (science line and bar graph)
    5·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which of the following is the most important, when working in the science laboratory?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!