1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
10

Population density ?

Biology
1 answer:
lora16 [44]3 years ago
4 0

Answer:

The amount of people per square mile or kilometer of land; also called arithmetic density.

You might be interested in
Can someone help me find the words>?
andrew11 [14]

I don't know how we can really help u

8 0
3 years ago
Read 2 more answers
Eukaryotic cells are compartmentalized into ____________ , which is not characteristic of prokaryotes. the chromosomes of eukary
likoan [24]
The first blank is organelles, the second blank is nucleus, the third blank is eukaryotes, the fourth blank is mitochondria, and the fifth blank is flagella.

Hope this helped!!
5 0
3 years ago
On the Galapagos islands, Charles Darwin studied many species of finches found nowhere else in the world. Each species had devel
Sedbober [7]

When Charles Darwin stepped ashore on the Galapagos Islands in September 1835, it was the start of five weeks that would change the world of science, although he did not know it at the time. Among other finds, he observed and collected the variety of small birds that inhabited the islands, but he did not realize their significance, and failed to keep good records of his specimens and where they were collected.


7 0
2 years ago
What happened to the West Nile virus genome that resulted in a new strain of the virus?
Vlada [557]

When there is a - in front of an expression in parentheses, change the sign of each term in the expression

7 0
3 years ago
Name Streptococcus agalactiae, what morphology would you expect these cells to have?
Colt1911 [192]

Answer:

round and in chains

Explanation:

<em>Streptococcus agalactiae </em>is a gram positive bacteria. It is facultative anaerobe and forms a part of microbiota in gastro intestinal and urinary tract of healthy humans. It can cause infections in immuno compromised beings.Its genus name describes its morphology. Coccus are round spherical shaped bacteria. Strepto means that the bacteria are present in chain form. Hence this bacteria is spherical and arranged in chains.  

There are several other types of bacterial morphology. For example: Staphylococcus means that the bacteria is again spherical but this time arranged in groups. Diplococcus means that the spherical bacteria is arranged in a pair. Similarly, bacillus is used to describe a rod shaped bacteria.

7 0
3 years ago
Other questions:
  • Process in which cells make atp by breaking down organic compounds
    8·1 answer
  • What evidence did Mendel find that supported his law of independent assortment?
    10·1 answer
  • During Anaphase I in Meiosis, what major event takes place Question 25 options: Sister chromatids are pulled apart. Chromosome p
    13·1 answer
  • Which of the following statements is true?
    8·1 answer
  • Those factors that are kept the same in the experimental group and the control group are called:
    15·1 answer
  • dalton propuso que el atomo posee electrones localizados en orbitas que rodean el nucleo. Cada orbita presenta una cantidad de e
    7·1 answer
  • 1. Nutrients flow and energy cycles in an ecosystem.<br> о<br> True<br> False
    7·1 answer
  • Which layer of the epidermis will be supplied with the highest levels of oxygen from the blood?
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Can someone help me with this thanks​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!