1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
3 years ago
13

Looking at a cell under a microscope, you note that it is a prokaryote. How do you know? (1 point)

Biology
2 answers:
Readme [11.4K]3 years ago
5 0
The correct option is C.
There are basically two types of cells, they are prokaryotic and eukaryotic cells. The eurkaryotic cell is a well developed cell that is usually find in multi cellular organisms while the prokaryotic cell is usually find in unicellular organisms. The prokaryotic cell is typically described as a primitive cell because it lacks nucleus and do not possess most of the remaining cell organelles. The organisms that possess prokaryotic cells are called prokaryotes. Examples of such organisms are bacteria and archaea.
Instead of nucleus, prokayotes possess a nucleiod region which contains the cell's DNA. Prokaryotic cells also possess cell wall, cytoplasm and ribosomes.
enot [183]3 years ago
4 0

A prokaryotic cell is devoid of a nucleus, unlike a eukaryotic cell.

Further Explanation:

A prokaryote is a single-celled organism that does not contain a distinct nucleus. It also lacks other membrane-bound organelles such as endoplasmic reticulum, mitochondria, chloroplast, and Golgi apparatus. For example, E. coli, archea, streptococcus bacteria, and Streptomyces bacteria. The region containing the DNA is called nucleoid. The nucleoid is not membrane bound.

The genetic material (DNA), proteins and other metabolites are present within the cytoplasm of a prokaryotic cell surrounded by a cell membrane and not in separate cellular compartments. Certain bacteria also contain flagellin protein which makes the flagellum required for chemotaxis. The physiological response of a bacteria in the direction of increasing or decreasing the concentration gradient of a particular molecule is chemotaxis.

The prokaryotes or bacteria might acquire four basic shapes: cocci, spiral, bacilli, and vibrio. A coccus shape represents a bacterium which is ovoid or spherical in appearance. A bacterium is called spiral when it contains spiral-shaped twisted rods. Some other bacteria have either cylindrical or comma-shaped and are hence called as bacillus or vibrio, respectively. The bacterial and archaeal species perform asexual reproduction, for example, binary fission.

On the other hand, the eukaryotes are multicellular as well as unicellular. The unicellular eukaryotes are algae, protozoa, and phytoplankton whereas, the multicellular eukaryotes are animals, brown algae, green algae, and fungi. The organelles present in the cytoplasm of the eukaryotic cell are mitochondria, chloroplast, nucleus, and Golgi apparatus. These organelles are bound by a membrane on the outside. The major part of DNA is present in the nucleus which is surrounded by a nuclear membrane whereas; mitochondria and chloroplast also contain some of the genetic material in the case of animals and plants respectively.

Learn more:

1. Learn more about science and society <u>brainly.com/question/1721226 </u>

2. Learn more about difference between law and theory <u>brainly.com/question/192651 </u>

3. Learn more about primary succession <u>brainly.com/question/1386621 </u>

<u> </u>

Answer Details:

Grade: High School

Subject: Biology

Chapter: Cell- The Unit of Life

Keywords:

Eukaryotes, prokaryotes, DNA, genetic material, membrane-bound organelles, nucleus, nucleoid, mitochondria, chloroplast, endoplasmic reticulum, multicellular, unicellular, single-celled organism, flagellum, flagellin.

You might be interested in
What does a cognitive neuroscientist study?
ratelena [41]
The thinking habits of your brain and how they could work
4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
PLEASE HELP WILL GET 30 POINTS AND BRAINLIEST AWNSER
koban [17]

Answer:

There are approximately five main climate types on Earth:

Tropical.

Dry.

Temperate.

Continental.

Polar.

6 0
2 years ago
Only number 2,3,4????????
tangare [24]
The first one is commensalism. The second one is mutualism. The last one is parasitism.
4 0
3 years ago
What is the difference between a species and a population?
adelina 88 [10]
Going back to naming and classifying all of the living organisms, let us take a look at what can be the difference between<span> a specie and </span>population<span>. ... It is defined as the organisms capable of sexual intercourse and producing offspring which are fertile and able to produce as well

</span>
8 0
3 years ago
Other questions:
  • How can natural selection account for a the long snout of an anteater
    10·2 answers
  • In the 1970s, archeologists unearthed a vast cemetery in the Atacama Desert of Chile. Because the Atacama is the driest desert o
    9·1 answer
  • Patient is admitted with dysuria due to a severe urinary tract infection. which diagnoses should be reported
    15·1 answer
  • I need help with question 6 plz!!
    7·1 answer
  • - comparing species definitions three of the most prominent definitions of species are the biological species concept, the phylo
    9·1 answer
  • Study the diagram of the selectively permeable membrane below.
    11·1 answer
  • Scientists hypothesize that there are no dinosaurs alive today because
    15·1 answer
  • Do buffalo compete for food with other herbivores? If so, for what food and when?
    12·2 answers
  • Dna strands serve as which of the following during dna synthesis
    8·1 answer
  • What is the process of photosynthesis???​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!