1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
3 years ago
6

Describe how humans’ way of life has changed. Begin with hunter-gatherers and end with life after the Industrial Revolution.

Biology
1 answer:
iragen [17]3 years ago
4 0

Answer:

Ever since the existence of life of humans on Earth, the humans have been making progress to understand themselves and the mother nature.

In the start, the humans were hunter- gatherers. Hunter- gatherers can be described as humans which use wild life plants and animals for food. The humans used to live in jungles and eat the wild- life plants and animals. They used leaves from the trees to cover their bodies. Heat was produced by rubbing the rocks.

After this time, the humans learned the techniques of cultivating plants for food. They started cultivating crops and depend on them for living. During this time, humans learned the art of farming and agriculture. But they couldn't understand the effects of various pathogens infecting the crops and humans at that time.

After this time, humans learned the art of preserving foods in different forms like pickles etc. They also learned that certain types of plants could be used to treat wounds and other diseases.

With the passage of time, people learned to make and use machinery for making their tasks easier. The usage of machinery progressed rapidly and the industrial revolution began. People became more diverted to this sector rather than farming. They started to move towards the cities to find better jobs in industries.

Life after industrial revolution was much easier as humans had made a lot of equipments which aid them to have a better life style. Science has been developing since that time day by day.

Explanation:

You might be interested in
You call to a friend from a boat floating in the ocean. Which best describes the changes in the speed of the sound waves as they
Alina [70]

The correct answer is: The speed of sound is faster in the water than in the air.  

The speed of sound is different between those two mediums because they have different densities. Since, water is denser than air, more energy is required to generate a wave but once it stars, it travels faster than it would do in air. Sound waves’ travel can be presented by particles that transmit the energy one to another as they bump. The sound speed is lower in the air (than in water) because particles are far apart, so they travel further before they collide.

8 0
3 years ago
How do the different levels of body organization work together so your body can function?
prisoha [69]

Answer: The human body is organized at different levels, starting with the cell. Cells are organized into tissues, and tissues form organs. Organs are organized into organ systems such as the skeletal and muscular systems

Explanation:

6 0
3 years ago
An igneous rock is found on the ground and has no identifiable crystals. What is the most likely origin of this rock?molten mate
quester [9]

The answer would be: <u>Molten material that cooled quickly.</u>


Igneous rocks are formed by the cooling of molten material. So we can cross out the last two choices. The rock has no identifiable crystals so it is most likely an Extrusive igneous rock. They form on the surface where they cool quickly.


Those that form underground are called intrusive rocks. They cool slowly allowing enough time for crystal formation.

4 0
3 years ago
Read 2 more answers
The center of a tornado is characterized by its _____.
Liula [17]

Answer:

c

Explanation:

high pressure

8 0
2 years ago
The function of the medulla oblongata is?
Scilla [17]

Answer:

d. It also includes , breathing, digestion, swallowing

5 0
2 years ago
Other questions:
  • Use of fossil fuels has increased the total amount of carbon in the carbon cycle.
    6·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Question 4 (2 points) Question 4 Unsaved
    8·1 answer
  • I WILL GIVE BRAINLIEST TO WHO ANSWER MY QUESTION AND PLEASE EXPLAIN TO!
    8·2 answers
  • Most of the volcanic activity on earth occurs where
    7·1 answer
  • What is the type of allele that only affects the phenotype in the homozygous condition?
    14·1 answer
  • Which types of freely moveable joints are often found in areas of the body, such as the shoulders and hips, needing movement in
    5·2 answers
  • Why do you think most transportation in the U.S. is still running on fossil fuels?
    13·1 answer
  • Chromosomes are duplicated during what stage of the cell cycle?
    14·1 answer
  • Are the predominant organic macromolecules in cells and are responsible for their structure, behavior, and unique qualities?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!