1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
7

Which of the following statements about government sanctioned activities to restore ecosystems is true? a. Government sanctioned

activities to restore ecosystems are not effective. b. Government sanctioned activities to restore ecosystems completely counteract the negative effects of human activity. c. Government sanctioned activities have been effective in helping to restore ecosystems, but do not replace prevention efforts. d. None of the above
Biology
1 answer:
kap26 [50]3 years ago
3 0

Answer:

Government sanctioned activities have been effective in helping to restore ecosystems, but do not replace prevention efforts. answer is c

Explanation:

You might be interested in
Que significa la expresión : "tener una efectividad del 99%"
vesna_86 [32]
Https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwjcv5ql4-TX...


6 0
3 years ago
What process is DNA going through inside the nucleus?
Nostrana [21]

Answer:

The nucleus houses the genetic material of the cell: DNA. DNA is normally found as a loosely contained structure called chromatin within the nucleus, where it is wound up and associated with a variety of histone proteins. When a cell is about to divide, the chromatin coils tightly and condenses to form chromosomes. hope this helped!

Explanation:

5 0
3 years ago
A man is heterozygous for sickle cell anemia and homozygous dominant for familial hypercholesterolemia. Knowing that these genes
Gre4nikov [31]
The answer <span>is AB and aB

<span>A man is heterozygous for sickle cell anemia: Aa
</span></span>A man is <span>homozygous dominant for familial hypercholesterolemia: BB

So, his genotype is AaBB. He will give only one allele of two for each gene.
He can have 2 different combinations in sperm cells:
- AB
- aB</span>
7 0
3 years ago
Read 2 more answers
Made from amino acids. Example: meat
Mars2501 [29]

Answer:

Amino acids are the building blocks of life and are encoded by DNA. Enzymes and structural proteins are made of amino acids, and are used as precursors for other important biomolecules in the body. In addition, many different industries ranging from pharmaceuticals to the food industry rely on amino acids.

3 0
3 years ago
Electrons are transferred in the formation of ______________ bonds. A) ionic B) covalent C) metallic D) all chemical
Sveta_85 [38]

Answer: A. ionic

In ionic bonds electron are transferred from one atom to another. In ionic bonds , the metal atom loses electrons to become positively charged cation whereas the nonmetal atom accepts those electrons to become negatively charged anion.

5 0
3 years ago
Read 2 more answers
Other questions:
  • A ________ is a model that imitates a real-world situation. What goes in the blank? Please help.
    5·1 answer
  • If DNA has the sequences of bases TCAAGT, the mRNA formed during transcription would have the sequence of
    11·2 answers
  • Having the same number of protons and electrons results in a positively charged atom.
    15·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The theory of endosymbiosis claims that millions of years ago, aerobic bacteria were taken inside of anaerobic cells through end
    11·2 answers
  • Where does the overwhelming amount of seismic activity occur on the earth?
    8·1 answer
  • cane toad, or Rhinella marina, was introduced to the Hawaiian Islands in 1932 by sugar cane farmers. The farmers released the to
    5·1 answer
  • How did Hershey and Chase use radioactivity to draw a conclusion about proteins and DNA?
    12·1 answer
  • In a nerve cell the nucleus and dendrites can be found at the _____________ . *
    8·2 answers
  • What adaptation is commonly found in organisms of deep pelagic and benthic communities?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!