Nuclear fusion occurs in the core area or centre of the Sun. Here, temperatures are around 15,000,000°C. Gravity pulls all of the mass of the Sun inwards, creating pressure so intense that nuclear reactions take place. The nuclei of hydrogen atoms smash together and fuse to form larger atoms such as helium nuclei.
        
                    
             
        
        
        
Answer:
Ectoparasites are organisms that live on the skin of a host, from which they derive their sustenance. The phylum Arthropoda includes the two-winged, or dipterous, flies. The larvae or maggots of these flies may invade the living or necrotic tissue of animals and humans, producing myiasis. Multiple dipterous flies are thought to be capable of producing ocular myiasis. It is thought that the larvae are embedded in the eye, that they burrow directly through the sclera and then under the retina. Typically, they leave asymptomatic tracks throughout the fundus, but a number of cases of destructive endophthalmitis have been reported, particularly from Scandinavia.
 
        
             
        
        
        
Answer:
Nicholas Steno
Explanation:
Nicholas Steno who was a Catholic priest establish relationship between sedimentary rock layers otherwise called stratigraphy.
Stratigraphy is a branch of geology that deals with the study of rock layers. He established theoretical law of stratigraphy by introducing law of superimposition, principle of original horizontality and the principle of lateral continuity in 1669 work of fossilization of organic matter sediments.
 
        
             
        
        
        
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is 
Explanation:
  1. AACGTACGATCGATGCACATGCATGGCTACGC
 Complementary strand  
      TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
  2. CCCGGGTATGCATGTACGTACGTCGTATATCG
 Complementary strand  
      GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand  
    GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand  
    AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
 
        
             
        
        
        
I think C, correct me if I’m wrong.