1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bingel [31]
3 years ago
6

How do animal cells complete the cell cycle

Biology
1 answer:
torisob [31]3 years ago
8 0
Animal cells complete the cell cycle because the nucleus in the cell and They replicate which make more cells
You might be interested in
The suns energy is classified by the
Travka [436]
Nuclear fusion occurs in the core area or centre of the Sun. Here, temperatures are around 15,000,000°C. Gravity pulls all of the mass of the Sun inwards, creating pressure so intense that nuclear reactions take place. The nuclei of hydrogen atoms smash together and fuse to form larger atoms such as helium nuclei.
6 0
3 years ago
Read 2 more answers
Write an essay on ectoparasites​<br> Example of ectoparasites
sesenic [268]

Answer:

Ectoparasites are organisms that live on the skin of a host, from which they derive their sustenance. The phylum Arthropoda includes the two-winged, or dipterous, flies. The larvae or maggots of these flies may invade the living or necrotic tissue of animals and humans, producing myiasis. Multiple dipterous flies are thought to be capable of producing ocular myiasis. It is thought that the larvae are embedded in the eye, that they burrow directly through the sclera and then under the retina. Typically, they leave asymptomatic tracks throughout the fundus, but a number of cases of destructive endophthalmitis have been reported, particularly from Scandinavia.

4 0
2 years ago
Who was the individual whose three principles led to a better understanding of the
andreev551 [17]

Answer:

Nicholas Steno

Explanation:

Nicholas Steno who was a Catholic priest establish relationship between sedimentary rock layers otherwise called stratigraphy.

Stratigraphy is a branch of geology that deals with the study of rock layers. He established theoretical law of stratigraphy by introducing law of superimposition, principle of original horizontality and the principle of lateral continuity in 1669 work of fossilization of organic matter sediments.

5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which energy conversion occurs in the cells of an animal, such as the
zimovet [89]
I think C, correct me if I’m wrong.
3 0
2 years ago
Read 2 more answers
Other questions:
  • Michael's monthly income is $3250. He has allotted 10% of his income to pay for housing expenses. What is the amount?
    6·1 answer
  • Before viewing prepared slides under a microscope, students should review the safety rules for
    10·2 answers
  • A destarched variegated plant was left in a sunny garden during the day for several hours.At the end of this period a leaf was t
    5·1 answer
  • Red-green color blindness is an X-linked recessive disorder.
    7·1 answer
  • Which statements describe the movement of blood through the heart? Select two options.
    14·2 answers
  • What sequence of amino acids would be coded by the following set of nucleotides?
    14·2 answers
  • All cells are surrounded by a cell wall​
    10·2 answers
  • Chemicals used to kill insects and other pests that diminish crop yields are called
    8·1 answer
  • Please do no.1 and 2!! Please and thank you so much!!
    11·2 answers
  • Choose the correct option that best identifies A, B, C, D, E, F, G
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!