1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
2 years ago
11

Which organizational pattern would probably be the most effective for arranging the main points of a speech with the specific pu

rpose "The three parts of an insect's body are the head, the thorax, and the abdomen"?
Biology
1 answer:
suter [353]2 years ago
5 0

Answer:

spatial

Explanation:

  • The pattern of organization is used by the writers to organize their ideas to effectively communicate the message.
  • The pattern of organization used can vary depending on the purpose of writing a statement.
  • The organizational pattern that is used in the sentence "The three parts of an insect's body are the head, the thorax, and the abdomen" is a spatial pattern.
  • Spatial organizational pattern organizes the information given in a sentence based on the physical relation of objects with each other. This pattern of organization is widely used by the writers to strike up an image of how the various parts are physically located.
  • Since in the given sentence the head, thorax, and abdomen are located one after the other in a cockroach's body, the pattern of organization used is spatial.
You might be interested in
What is the kinetic energy of a 1,200 kg object that is moving at a speed of 24 m/s​
Anit [1.1K]
The Kinetic energy is 345,600 J

=1/2^2

6 0
3 years ago
Biology &amp; Behavior: Evolution &amp; Genetics<br> Why people behave the way they do?
xxTIMURxx [149]

People behave the way they do because of situation as well as genetics.

<h3>Why people behave the way they do?</h3>

People behave as they do in response to the way they are treated by other people as well as in response to situation. In their behaviour, they have also a genetic factor that influence their behaviour.

So we can conclude that people behave the way they do because of situation as well as genetics.

Learn more about behaviour here: brainly.com/question/1741474

#SPJ1

6 0
2 years ago
Where are electrons located
Inga [223]

Explanation:

where is the pic........po

5 0
2 years ago
Read 2 more answers
Need a answer quickly anything will help.
shutvik [7]

Answer:

What's your question?

Explanation:

6 0
2 years ago
Read 2 more answers
What is average size clutch of sea turtle egg
MA_775_DIABLO [31]
<span>sea turtles lay 110 eggs in a nest</span>
4 0
3 years ago
Other questions:
  • When fatty acids cannot pack together tight enough to make a solid fat, they have ...
    7·1 answer
  • Why does valerie's tumor dna sample have fewer bands than the peripheral blood?
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Why has the solar system model been extremely useful to people and in the field of science?
    8·2 answers
  • Which refers to the highness or lowness of a sound? pitch amplitude frequency softness
    13·1 answer
  • Which of these elements are the least dense?
    5·1 answer
  • Two women gave birth to girls in the same hospital at the same time. The nurses think they may have accidentally switched the ba
    9·1 answer
  • Define nutrient and thermal pollution.
    8·1 answer
  • Which of these organisms would most likely live in a intertidal zone?
    5·1 answer
  • Earth scientists have concluded that the methods of harnessing energy that have been used over the past tWO
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!