1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhannawk [14.2K]
3 years ago
9

The two cerebral hemispheres are separated by the

Biology
1 answer:
MAXImum [283]3 years ago
6 0

Answer:

The correct answer is A. The two cerebral hemispheres are separated by the longitudinal fissure.

Explanation:

The longitudinal or intercerebral fissure is a deep cleft that divides the brain longitudinally into two hemispheres (the right and the left) joined together by the corpus callosum. Other fissures, such as the central sulcus, the lateral sulcus and the internal perpendicular fissure, divide each hemisphere into large cerebral lobes, which in turn have cerebral convolutions.

You might be interested in
One major difference between plant and animal cells is that plant cells are the only ones with
amm1812
They are the only cells with chloroplast 
7 0
4 years ago
Read 2 more answers
The atom of an element has 4 protons and 5 neutrons. Its atomic number is?
N76 [4]

Answer:

atomic number is 4 and neutron is 12

5 0
3 years ago
Read 2 more answers
What is the relationship between biodiversity and number of populations?
noname [10]
Biodiversity increases as the number of populations grow, because a greater population generally means a more diverse one.

However, this is not always true, so I'm not sure what answer they're looking for.
7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Plz help guys middle school sucks, 59 points if you can answer!!
alexdok [17]

A catalyst increase a chemical reaction, therefore making the answer B. Promotes a chemical reaction.

Hope I could help! :)

5 0
3 years ago
Read 2 more answers
Other questions:
  • What are the advantages of housing a telescope inside mountain of observatories?​
    10·1 answer
  • Which areas of the world are not considered biomes? *
    6·2 answers
  • What is the difference in inheritance between boys and girls for sex linked<br> traits
    8·2 answers
  • In the mouse, gene A allows pigmentation to be deposited in the individual coat hairs; its allele a prevents such deposition of
    12·1 answer
  • The type of mutation that alters the nucleotide sequence of a gene but does not alter the amino acid sequence of the protein pro
    8·1 answer
  • Hello there can anyone help me?
    13·1 answer
  • Cooking improves the taste of food and makes it easy to digest . Are any nutrients lost .Explain
    8·1 answer
  • Two pure substances combine to make a new substance. The new substance cannot be
    7·1 answer
  • What drives the flow of water to move from the ocean to the atmosphere?? is it
    12·1 answer
  • Large predators can also be problematic to eat because of bioaccumulation and biomagnification of toxins such as lead or mercury
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!