The experimental group is the group you change from the normal. the fertilizer group is experimental
Adhesion depends on binding between specific molecules on both the host and pathogen so that the pathogen can gain a stable foothold on host tissues.
<h3>What is adhesion?</h3>
In epidemiology, adhesion makes reference to the process in which pathogen and host interact during an infection.
The adhesion process is fundamental to reach the survival of the pathogen during a particular infection.
These pathogens can be any type of microorganism able to cause harm to the host (e.g., bacteria and fungi).
Learn more about the adhesion process here:
brainly.com/question/15024792
Answer:
1- D,C,A,B,E- 2 - B,A,C,D- 3- C,D,B,A.
Explanation:
Answer:
Disruption such as deforestation or mining can destroy the habitat, leading to water pollution, mud slides, and loss of soil. With the habitat affected, the animals the grey fox feeds on, such as rabbits or mice, will be affected as well, leading to the grey fox losing a source of food. By limiting the diet of the grey fox, other predators will be more likely to compete with the grey fox, disrupting its niche.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
