1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
9

Which has more molecules, a mole of Silver (Ag) or a mole of tin (Sb)?

Biology
1 answer:
LiRa [457]3 years ago
8 0

Answer:

they are the same

Explanation:

since one mole is 6.022×10^23 atoms, one mole of silver is 6.022×10^23 atoms and one mole of tin is 6.022×10^23 atoms. so one mole of tin has the same number of atoms as one mole of silver

You might be interested in
3. Look at the pictures beow and answer the following questions,
tankabanditka [31]

Answer: If the carbon bonds are on a different charge or one is not charged evenly it will break or maybe misshape the membrane.

Explanation:

5 0
3 years ago
WILL GIVE BRAINLIEST!!
motikmotik
ANSWER:

Synonyms for light:

flash, glimmer, glint, glitter, scintillation, shimmer, sparkle, twinkle
daylight, moonlight, sunlight, sunshine
afterglow, aureole (or aureola), aurora, beam, halo, ray, shaft, streak, stream, sunbeam
glisten, gloss, luster (or lustre), polish, reflection, sheen

Antonyms for light:

blackness, dark, darkness, dimness, dusk, duskiness, gloom, night, shadow

best of luck!! :)

help me by marking as brainliest!!
4 0
2 years ago
Growth factors and cytokines both lead to tyrosine phosphorylation through receptors, but they do so through different mechanism
gladu [14]

Answer:

The growth factor receptors have a kinase domain while the Cytokines receptors do not contain a kinase domain as part of their structure.

Explanation:

The two are signaling molecules that control cell activities in some manners, such paracrine, endocrine and autocrine manners.

The receptor kinase domain can be specific for substrate sites in which phosphorylation occurs.

3 0
3 years ago
When problem solving and making decisions, your rational thought is
Umnica [9.8K]

Answer:

b

Explanation:

that is the answer thanx

7 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • Why do environmental scientists use systems and diagrams to explain process in ecosystems
    7·1 answer
  • The process through which professional scientists evaluate the quality of each others research is called
    7·1 answer
  • Vivian Andrews is your next-door neighor. Vivian is 30 years
    13·1 answer
  • Figure 1. Model of water movement through the xylem, with magnified models of water movement in the stem and leaf. Which stateme
    15·1 answer
  • A student poured a solution of bromothymol blue indicator into three test tubes. Then he placed an aquatic plant in two of the t
    5·1 answer
  • The part of a neuron which contains the nucleus and has a complete set of the neuron
    15·2 answers
  • The dnas produced in a dna sequencing reaction are analyzed on the basis of their ______.
    11·1 answer
  • Select all that apply.
    10·2 answers
  • Why is it important that tissues are composed of specialized cells?
    13·1 answer
  • Cuál es la relación entre instinto Y aprendizaje
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!