1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
3 years ago
9

Which challenge did John Roebling face when designing and building the Brooklyn Bridge?

Biology
2 answers:
Oliga [24]3 years ago
7 0
That is really big oof wish I could help ya
stealth61 [152]3 years ago
4 0

Answer:

the correct answer is C

Explanation:

You might be interested in
How does guard cells structure relate to its function?​
BartSMP [9]

Answer: Guard cells are cells surrounding each stoma. They help to regulate the rate of transpiration by opening and closing the stomata.

8 0
3 years ago
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
A 14-year-old has just had a plaster cast placed on his lower left leg. to provide safe cast care, the nurse should:
Murljashka [212]
<span>The cast should only be handled with the palms of the nurse's hands as it is drying. This will allow for a smooth surface to form on the cast instead of dents and imperfections in the surface which could lead to movement issues during healing.</span>
8 0
3 years ago
What are the reactants in the following chemical formula? <br> C6H12O6 + 6O2 → 6CO2 + 6H2O
Luda [366]
That is the chemical formula for photosynthesis
8 0
3 years ago
A point in development when organisms are particularly susceptible to certain kinds of stimuli in their environments, but the ab
kaheart [24]

The correct answer is B. Sensitive period

Explanation:

In development, the sensitive period refers to a lapse of time in which organisms are more susceptible or receptive to stimuli and therefore during this time there can be great advances in development. Additionally, different from critical periods sensitive periods do not imply irreversible consequence if the stimuli are not presented. For example, in human beings from birth to the age of 6 years, children are more receptive to learn and acquire certain skills such as learning a new language if exposed to it and therefore this can be considered as a sensitive period. Considering this, it can be concluded the definition presented refers to the Sensitive period.

7 0
3 years ago
Other questions:
  • Imagine your soil is basic, with a pH of 8.5. In soils with a high pH, minerals like iron, manganese, and phosphorus are less av
    15·1 answer
  • Write any two features of cell?​
    12·2 answers
  • Which would most likely cause a forced migration due to loss of habitat?
    15·2 answers
  • 2. which of the following correctly identifies active transport?
    14·2 answers
  • According to your data what are the approximate half-lives of the hypothetical elements a, b, c, d?
    13·1 answer
  • The genetic information in human and chimpanzee DNA shows a high degree of similarity, as humans share about 96-99% of their DNA
    6·1 answer
  • I need help renaming a bar graph with a title like this one "Respiration of Carbohydrates by Yeast" but it has to be about water
    8·1 answer
  • Analyze the role and modern-day actions of the United Nations in stopping nuclear proliferation.
    12·1 answer
  • Which of the following correctly describes distinguishing characteristics of the Kingdom Plantae?
    9·2 answers
  • Cells store waste in ________.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!