Soil composition would be best for availability of nutrients, water, and root development higher proportion of humus; lower amounts of clay and sand
Compared to the lower soil layers, the topsoil or surface soil often includes more organic matter and air but less clay. The topsoil typically has the highest concentration of plant roots and is more fertile than the other layers.
- Nutrient management includes managing the composition of the soil. Minerals, organic material, water, and air are the fundamental elements of soil. Typically, 45% of the soil is made up of minerals. 5% organic material 20–30% water and 20–30% air are used. At best, these percentages are merely generalizations.
- Numerous nutrients are found in soil, which are obtained from dead plants and animals. The plants eat these nutrients as nourishment. So soil contributes to the growth of plants by giving them sustenance in the form of nutrients.
To learn more about Soil composition it visit : brainly.com/question/15015701
#SPJ4
Glacial evidence discovered in South America demonstrates how climate change evidence has bolstered the notion of continental drift. Folded mountains in Africa and South America. Thus, the correct option is D.
Climate change is happening all across the planet on a daily basis. This is primarily due to human activities that have had an impact on the atmosphere and the earth.
<h3>
What is continental drift?</h3>
Continental drift is basically the hypothesis that the continents once constituted a single landmass, disintegrated, and drifted to their current places.
The discovery of glacial evidence in South America has led to a greater acceptance of the continental drift idea.
Finally, we can conclude that glacial evidence discovered in South America demonstrates how climatic change evidence supports the hypothesis of continental drift.
For more information regarding continental drift, visit:
brainly.com/question/974409
#SPJ1
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Animal cells are typical of the eukaryotic cell, so that's what they are made out of hope it helps
Explanation: