1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
3 years ago
9

Which diagram represents the type of asexual reproduction known as regeneration?

Biology
2 answers:
Roman55 [17]3 years ago
5 0
The second diagram best represents regeneration
Black_prince [1.1K]3 years ago
3 0

Answer:

Mitosis?

Explanation:

Mitosis doesn't use sperm cells, because its ASEXUAL

You might be interested in
What type of chemical reaction breaks down nutrients and stores their energy as ATP?
Andrews [41]

Answer:

Cellular Respiration

Explanation:

7 0
3 years ago
What soil composition would be best for availability of nutrients, water, and root development? A. equal amounts of sand, clay,
Travka [436]

Soil composition would be best for availability of nutrients, water, and root development higher proportion of humus; lower amounts of clay and sand

Compared to the lower soil layers, the topsoil or surface soil often includes more organic matter and air but less clay. The topsoil typically has the highest concentration of plant roots and is more fertile than the other layers.

  • Nutrient management includes managing the composition of the soil. Minerals, organic material, water, and air are the fundamental elements of soil. Typically, 45% of the soil is made up of minerals. 5% organic material 20–30% water and 20–30% air are used. At best, these percentages are merely generalizations.
  • Numerous nutrients are found in soil, which are obtained from dead plants and animals. The plants eat these nutrients as nourishment. So soil contributes to the growth of plants by giving them sustenance in the form of nutrients.

To learn more about Soil composition it visit : brainly.com/question/15015701

#SPJ4

3 0
1 year ago
Which indicates how evidence of climate change supports the theory of continental drift?
beks73 [17]

Glacial evidence discovered in South America demonstrates how climate change evidence has bolstered the notion of continental drift. Folded mountains in Africa and South America. Thus, the correct option is D.

Climate change is happening all across the planet on a daily basis. This is primarily due to human activities that have had an impact on the atmosphere and the earth.

<h3>What is continental drift?</h3>

Continental drift is basically the hypothesis that the continents once constituted a single landmass, disintegrated, and drifted to their current places.

The discovery of glacial evidence in South America has led to a greater acceptance of the continental drift idea.

Finally, we can conclude that glacial evidence discovered in South America demonstrates how climatic change evidence supports the hypothesis of continental drift.

For more information regarding continental drift, visit:

brainly.com/question/974409

#SPJ1

4 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Animals are made up of which type of cells?
Irina-Kira [14]

Animal cells are typical of the eukaryotic cell, so that's what they  are made out of hope it helps

Explanation:

4 0
2 years ago
Read 2 more answers
Other questions:
  • Many species have embryos that look similar to one another and develop similar structures. Refer to the picture above. During th
    15·2 answers
  • Which of the following is not part of the integumentary system?
    9·2 answers
  • SOMEONE PLEASE ANSWER THIS FOR BRAINLIEST!!!!!
    9·2 answers
  • Which of the following is not a characteristic of Arthropods that has attributed to their diversity and success?
    14·1 answer
  • How many years does it take for the sun to pass the earth
    9·1 answer
  • State one specific way the removal of trees from an area has had a negative impact on the environment.
    10·2 answers
  • the kingdom, one of six kingdoms of life, is known for it's ability to survive in extreme enviroments
    14·1 answer
  • Helpppp omg gdkdnfjf
    13·2 answers
  • Which reactant of photosynthesis is also involved in climate change?
    9·1 answer
  • Which fully grown animal has the fastest average heart rate?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!